Incidental Mutation 'R8113:Ppp5c'
ID631002
Institutional Source Beutler Lab
Gene Symbol Ppp5c
Ensembl Gene ENSMUSG00000003099
Gene Nameprotein phosphatase 5, catalytic subunit
SynonymsANP receptor, PP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8113 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17004640-17027924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17009007 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000003183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003183]
Predicted Effect probably benign
Transcript: ENSMUST00000003183
AA Change: T229A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003183
Gene: ENSMUSG00000003099
AA Change: T229A

DomainStartEndE-ValueType
TPR 28 61 1.92e-6 SMART
TPR 62 95 8.29e0 SMART
TPR 96 129 4.28e-4 SMART
PP2Ac 204 480 2.8e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142597
SMART Domains Protein: ENSMUSP00000122783
Gene: ENSMUSG00000003099

DomainStartEndE-ValueType
TPR 27 60 1.92e-6 SMART
TPR 61 94 8.29e0 SMART
TPR 95 128 4.28e-4 SMART
PP2Ac 203 457 1.83e-145 SMART
Meta Mutation Damage Score 0.1631 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in cell cycle check-point arrest following treatment with ionizing radition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,321,803 S625P probably damaging Het
Agpat1 T C 17: 34,611,612 V170A probably damaging Het
Alg9 C T 9: 50,808,780 Q519* probably null Het
Apol8 C T 15: 77,750,136 R80H probably benign Het
Arhgap25 G T 6: 87,488,305 S118* probably null Het
Arhgap30 T A 1: 171,397,518 Y47* probably null Het
Arhgap42 C T 9: 9,011,433 D451N probably damaging Het
Cabp2 T A 19: 4,085,582 F91I probably damaging Het
Ccdc30 T C 4: 119,373,746 E108G probably benign Het
Cfap99 T C 5: 34,301,419 S53P probably damaging Het
Clec5a C T 6: 40,579,427 R135H possibly damaging Het
Cops8 T G 1: 90,603,603 D18E probably benign Het
Cped1 A T 6: 22,233,481 M779L possibly damaging Het
Cyp4x1 G A 4: 115,110,066 H438Y probably damaging Het
Disc1 A T 8: 125,088,275 T293S probably benign Het
Ercc1 T C 7: 19,350,177 L113S probably damaging Het
Ermp1 G T 19: 29,615,796 N765K probably benign Het
Fam83c A G 2: 155,834,820 I10T probably benign Het
Farp1 T C 14: 121,275,596 V788A probably benign Het
Fbn1 C G 2: 125,477,569 G92R probably damaging Het
Fsd1 T A 17: 55,995,881 M328K probably benign Het
Fzd3 C A 14: 65,202,813 S636I probably benign Het
Gapvd1 A G 2: 34,704,318 S886P probably damaging Het
Gatad2b T A 3: 90,341,722 D22E probably benign Het
Gm10436 T C 12: 88,177,080 Y329C probably benign Het
Gm30302 G A 13: 49,786,072 R721C probably benign Het
Gm7168 A T 17: 13,948,976 K202* probably null Het
Gmps T C 3: 63,980,269 I54T probably damaging Het
Gp6 A G 7: 4,394,115 I107T probably benign Het
Gpat2 T C 2: 127,431,347 V217A possibly damaging Het
Hdlbp T A 1: 93,417,195 I863F probably damaging Het
Hmcn1 A C 1: 150,749,090 I1021M possibly damaging Het
Igkv6-14 C T 6: 70,435,103 A66T probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqch A G 9: 63,454,573 I925T probably benign Het
Kcnt1 A G 2: 25,901,211 E522G possibly damaging Het
Kremen2 C G 17: 23,743,802 E103D probably damaging Het
Lig4 G T 8: 9,973,485 N98K probably benign Het
Lrrc3b T G 14: 15,358,232 I125L probably benign Het
Lrrc4 T C 6: 28,829,903 D148G probably damaging Het
Lrsam1 A G 2: 32,947,889 Y218H possibly damaging Het
Mmrn2 G A 14: 34,397,636 V191I probably benign Het
Nadk T A 4: 155,570,670 probably null Het
Napb C A 2: 148,709,431 A61S possibly damaging Het
Ncan T A 8: 70,108,571 D582V possibly damaging Het
Ncl T C 1: 86,356,642 D244G possibly damaging Het
Nlrp14 A G 7: 107,192,508 N800S possibly damaging Het
Nlrp9b C T 7: 20,019,335 T55M probably benign Het
Nobox G A 6: 43,306,017 T228I probably benign Het
Npffr1 C A 10: 61,613,971 P8H possibly damaging Het
Nrg2 T C 18: 36,021,103 Y587C probably damaging Het
Nsd1 T G 13: 55,245,621 V448G probably benign Het
Olfr1016 A G 2: 85,799,667 L201P probably damaging Het
Olfr228 T G 2: 86,483,068 I225L probably damaging Het
Olfr263 T A 13: 21,133,201 V142D probably benign Het
Olfr513 G T 7: 108,755,231 C125F probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Prr5 C T 15: 84,693,792 R101C probably damaging Het
Psg22 T C 7: 18,723,062 M290T probably benign Het
Pzp C T 6: 128,513,731 probably null Het
Rapgef6 T C 11: 54,625,958 V347A probably benign Het
Rttn A T 18: 89,010,916 H586L probably damaging Het
Sema3f A T 9: 107,688,076 I259K possibly damaging Het
Sgpp1 A T 12: 75,716,600 L269Q probably damaging Het
Slc22a8 A C 19: 8,605,539 I195L probably benign Het
Slc35a5 T C 16: 45,142,188 T425A unknown Het
Stard13 G A 5: 151,063,505 T180I probably damaging Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svil A T 18: 5,062,385 T902S probably damaging Het
Tnfaip8l3 T A 9: 54,027,137 R185W probably damaging Het
Ttn A T 2: 76,760,049 D21105E probably benign Het
Vmn2r109 T A 17: 20,554,467 M209L probably benign Het
Vmn2r125 A G 4: 156,351,347 H340R probably damaging Het
Zfp946 T C 17: 22,455,500 C412R probably damaging Het
Other mutations in Ppp5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Ppp5c APN 7 17008630 missense possibly damaging 0.87
IGL02794:Ppp5c APN 7 17006960 missense probably benign 0.15
IGL02831:Ppp5c APN 7 17008645 missense probably damaging 1.00
IGL02950:Ppp5c APN 7 17006910 missense probably benign 0.00
Persephone UTSW 7 17022443 missense probably benign 0.01
R0078:Ppp5c UTSW 7 17027725 missense probably benign 0.09
R0366:Ppp5c UTSW 7 17022583 nonsense probably null
R1102:Ppp5c UTSW 7 17022443 missense probably benign 0.01
R1511:Ppp5c UTSW 7 17009982 missense probably damaging 1.00
R1518:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R1714:Ppp5c UTSW 7 17008703 missense probably benign 0.01
R1754:Ppp5c UTSW 7 17005310 missense probably benign 0.20
R2380:Ppp5c UTSW 7 17006115 missense probably damaging 1.00
R2431:Ppp5c UTSW 7 17015425 missense probably damaging 0.99
R4854:Ppp5c UTSW 7 17009022 missense probably benign 0.00
R4974:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R5303:Ppp5c UTSW 7 17005284 missense probably benign
R5626:Ppp5c UTSW 7 17027704 missense probably benign
R5785:Ppp5c UTSW 7 17027691 critical splice donor site probably null
R6059:Ppp5c UTSW 7 17027907 unclassified probably benign
R6855:Ppp5c UTSW 7 17006966 missense possibly damaging 0.95
R7760:Ppp5c UTSW 7 17006349 missense probably damaging 1.00
R7885:Ppp5c UTSW 7 17006186 missense possibly damaging 0.86
R7922:Ppp5c UTSW 7 17027800 missense possibly damaging 0.72
R8170:Ppp5c UTSW 7 17007146 missense probably damaging 0.99
X0026:Ppp5c UTSW 7 17007110 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCATGCAAGACACAATGGGAG -3'
(R):5'- ATGACACATAGGCCAGATCAG -3'

Sequencing Primer
(F):5'- CACAATGGGAGGGACACAGC -3'
(R):5'- GATCAGATCACCACTTGAGGGC -3'
Posted On2020-06-30