Incidental Mutation 'R8113:Lig4'
ID631008
Institutional Source Beutler Lab
Gene Symbol Lig4
Ensembl Gene ENSMUSG00000049717
Gene Nameligase IV, DNA, ATP-dependent
SynonymsDNA ligase IV, 5830471N16Rik, tiny
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8113 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location9969049-9977686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9973485 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 98 (N98K)
Ref Sequence ENSEMBL: ENSMUSP00000093130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048216] [ENSMUST00000095476] [ENSMUST00000139793] [ENSMUST00000170033]
Predicted Effect probably benign
Transcript: ENSMUST00000048216
SMART Domains Protein: ENSMUSP00000036730
Gene: ENSMUSG00000040396

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Abhydrolase_5 116 299 5.6e-24 PFAM
Pfam:Abhydrolase_3 117 279 1.7e-6 PFAM
Pfam:Abhydrolase_6 117 310 4.9e-15 PFAM
Pfam:Abhydrolase_1 143 245 1.8e-8 PFAM
Pfam:AXE1 163 229 3.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095476
AA Change: N98K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093130
Gene: ENSMUSG00000049717
AA Change: N98K

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 14 209 1.3e-43 PFAM
Pfam:DNA_ligase_A_M 248 451 2e-50 PFAM
Pfam:DNA_ligase_A_C 476 588 3.3e-16 PFAM
BRCT 656 733 2.8e-14 SMART
Pfam:DNA_ligase_IV 749 784 7.3e-21 PFAM
BRCT 816 901 1.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139793
SMART Domains Protein: ENSMUSP00000116130
Gene: ENSMUSG00000040396

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Hydrolase_4 111 250 2.5e-11 PFAM
Pfam:Abhydrolase_1 115 237 3.2e-11 PFAM
Pfam:Abhydrolase_5 116 299 6.3e-24 PFAM
Pfam:Abhydrolase_6 117 241 2.9e-8 PFAM
Pfam:AXE1 162 229 9.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170033
AA Change: N98K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130807
Gene: ENSMUSG00000049717
AA Change: N98K

DomainStartEndE-ValueType
Pfam:DNA_ligase_A_N 15 208 8.8e-39 PFAM
Pfam:DNA_ligase_A_M 248 451 2.3e-52 PFAM
Pfam:DNA_ligase_A_C 476 588 4.8e-18 PFAM
BRCT 656 733 2.9e-14 SMART
Pfam:DNA_ligase_IV 750 783 5.5e-17 PFAM
BRCT 816 901 1.6e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes die late in gestation with extensive CNS apoptosis, blocked lymphopoeiesis and failure of V(D)J joining. Carrier fibroblasts show elevated chromosome breaks. ~40% of homozygous hypomorphs survive, with retarded growth, reduced PBL and progressive loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,321,803 S625P probably damaging Het
Agpat1 T C 17: 34,611,612 V170A probably damaging Het
Alg9 C T 9: 50,808,780 Q519* probably null Het
Apol8 C T 15: 77,750,136 R80H probably benign Het
Arhgap25 G T 6: 87,488,305 S118* probably null Het
Arhgap30 T A 1: 171,397,518 Y47* probably null Het
Arhgap42 C T 9: 9,011,433 D451N probably damaging Het
Cabp2 T A 19: 4,085,582 F91I probably damaging Het
Ccdc30 T C 4: 119,373,746 E108G probably benign Het
Cfap99 T C 5: 34,301,419 S53P probably damaging Het
Clec5a C T 6: 40,579,427 R135H possibly damaging Het
Cops8 T G 1: 90,603,603 D18E probably benign Het
Cped1 A T 6: 22,233,481 M779L possibly damaging Het
Cyp4x1 G A 4: 115,110,066 H438Y probably damaging Het
Disc1 A T 8: 125,088,275 T293S probably benign Het
Ercc1 T C 7: 19,350,177 L113S probably damaging Het
Ermp1 G T 19: 29,615,796 N765K probably benign Het
Fam83c A G 2: 155,834,820 I10T probably benign Het
Farp1 T C 14: 121,275,596 V788A probably benign Het
Fbn1 C G 2: 125,477,569 G92R probably damaging Het
Fsd1 T A 17: 55,995,881 M328K probably benign Het
Fzd3 C A 14: 65,202,813 S636I probably benign Het
Gapvd1 A G 2: 34,704,318 S886P probably damaging Het
Gatad2b T A 3: 90,341,722 D22E probably benign Het
Gm10436 T C 12: 88,177,080 Y329C probably benign Het
Gm30302 G A 13: 49,786,072 R721C probably benign Het
Gm7168 A T 17: 13,948,976 K202* probably null Het
Gmps T C 3: 63,980,269 I54T probably damaging Het
Gp6 A G 7: 4,394,115 I107T probably benign Het
Gpat2 T C 2: 127,431,347 V217A possibly damaging Het
Hdlbp T A 1: 93,417,195 I863F probably damaging Het
Hmcn1 A C 1: 150,749,090 I1021M possibly damaging Het
Igkv6-14 C T 6: 70,435,103 A66T probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqch A G 9: 63,454,573 I925T probably benign Het
Kcnt1 A G 2: 25,901,211 E522G possibly damaging Het
Kremen2 C G 17: 23,743,802 E103D probably damaging Het
Lrrc3b T G 14: 15,358,232 I125L probably benign Het
Lrrc4 T C 6: 28,829,903 D148G probably damaging Het
Lrsam1 A G 2: 32,947,889 Y218H possibly damaging Het
Mmrn2 G A 14: 34,397,636 V191I probably benign Het
Nadk T A 4: 155,570,670 probably null Het
Napb C A 2: 148,709,431 A61S possibly damaging Het
Ncan T A 8: 70,108,571 D582V possibly damaging Het
Ncl T C 1: 86,356,642 D244G possibly damaging Het
Nlrp14 A G 7: 107,192,508 N800S possibly damaging Het
Nlrp9b C T 7: 20,019,335 T55M probably benign Het
Nobox G A 6: 43,306,017 T228I probably benign Het
Npffr1 C A 10: 61,613,971 P8H possibly damaging Het
Nrg2 T C 18: 36,021,103 Y587C probably damaging Het
Nsd1 T G 13: 55,245,621 V448G probably benign Het
Olfr1016 A G 2: 85,799,667 L201P probably damaging Het
Olfr228 T G 2: 86,483,068 I225L probably damaging Het
Olfr263 T A 13: 21,133,201 V142D probably benign Het
Olfr513 G T 7: 108,755,231 C125F probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Ppp5c T C 7: 17,009,007 T229A probably benign Het
Prr5 C T 15: 84,693,792 R101C probably damaging Het
Psg22 T C 7: 18,723,062 M290T probably benign Het
Pzp C T 6: 128,513,731 probably null Het
Rapgef6 T C 11: 54,625,958 V347A probably benign Het
Rttn A T 18: 89,010,916 H586L probably damaging Het
Sema3f A T 9: 107,688,076 I259K possibly damaging Het
Sgpp1 A T 12: 75,716,600 L269Q probably damaging Het
Slc22a8 A C 19: 8,605,539 I195L probably benign Het
Slc35a5 T C 16: 45,142,188 T425A unknown Het
Stard13 G A 5: 151,063,505 T180I probably damaging Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svil A T 18: 5,062,385 T902S probably damaging Het
Tnfaip8l3 T A 9: 54,027,137 R185W probably damaging Het
Ttn A T 2: 76,760,049 D21105E probably benign Het
Vmn2r109 T A 17: 20,554,467 M209L probably benign Het
Vmn2r125 A G 4: 156,351,347 H340R probably damaging Het
Zfp946 T C 17: 22,455,500 C412R probably damaging Het
Other mutations in Lig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lig4 APN 8 9972775 missense probably damaging 1.00
IGL00655:Lig4 APN 8 9973305 missense probably benign 0.09
IGL01388:Lig4 APN 8 9973586 missense probably damaging 1.00
IGL01669:Lig4 APN 8 9973673 missense probably benign 0.01
IGL01757:Lig4 APN 8 9971185 missense probably benign 0.10
IGL02115:Lig4 APN 8 9973247 missense possibly damaging 0.58
IGL02167:Lig4 APN 8 9971821 missense probably benign 0.06
IGL02239:Lig4 APN 8 9972473 missense probably damaging 1.00
IGL02576:Lig4 APN 8 9971116 missense probably damaging 1.00
IGL02955:Lig4 APN 8 9972103 missense possibly damaging 0.95
IGL03056:Lig4 APN 8 9972580 missense possibly damaging 0.90
posey UTSW 8 9972955 missense probably damaging 1.00
posey2 UTSW 8 9971585 missense probably benign
BB004:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
BB014:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R0791:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1208:Lig4 UTSW 8 9971062 missense probably damaging 1.00
R1368:Lig4 UTSW 8 9971176 missense possibly damaging 0.89
R1522:Lig4 UTSW 8 9973012 missense possibly damaging 0.70
R1566:Lig4 UTSW 8 9973650 missense probably benign 0.41
R1674:Lig4 UTSW 8 9971692 missense probably benign 0.01
R2024:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2025:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2026:Lig4 UTSW 8 9972436 missense probably damaging 1.00
R2155:Lig4 UTSW 8 9972766 missense probably benign 0.00
R2243:Lig4 UTSW 8 9972161 missense possibly damaging 0.81
R2917:Lig4 UTSW 8 9971596 missense possibly damaging 0.56
R4763:Lig4 UTSW 8 9972955 missense probably damaging 1.00
R4819:Lig4 UTSW 8 9971885 missense probably benign
R5153:Lig4 UTSW 8 9973003 missense possibly damaging 0.95
R5397:Lig4 UTSW 8 9972644 missense probably benign 0.01
R5618:Lig4 UTSW 8 9972021 missense probably benign
R6102:Lig4 UTSW 8 9972872 missense probably damaging 1.00
R6210:Lig4 UTSW 8 9971585 missense probably benign
R6312:Lig4 UTSW 8 9971739 missense probably benign
R6955:Lig4 UTSW 8 9973384 missense probably damaging 1.00
R6991:Lig4 UTSW 8 9971098 missense probably damaging 0.99
R7207:Lig4 UTSW 8 9972101 nonsense probably null
R7769:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R7927:Lig4 UTSW 8 9973629 missense possibly damaging 0.92
R8124:Lig4 UTSW 8 9972954 missense probably damaging 1.00
R8382:Lig4 UTSW 8 9972346 missense probably damaging 1.00
R8443:Lig4 UTSW 8 9973777 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGAGTTATTGCTGGCAAC -3'
(R):5'- TGTTCCACACTAGAACGGATAC -3'

Sequencing Primer
(F):5'- CCAGAGTTATTGCTGGCAACTAAGTC -3'
(R):5'- AATCAGGCACTTCAAGGAGTTTTTGG -3'
Posted On2020-06-30