Incidental Mutation 'R8113:Gm30302'
ID631023
Institutional Source Beutler Lab
Gene Symbol Gm30302
Ensembl Gene ENSMUSG00000114073
Gene Namepredicted gene, 30302
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R8113 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49784765-49799001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49786072 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 721 (R721C)
Ref Sequence ENSEMBL: ENSMUSP00000152227 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000220773
AA Change: R721C

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223497
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,321,803 S625P probably damaging Het
Agpat1 T C 17: 34,611,612 V170A probably damaging Het
Alg9 C T 9: 50,808,780 Q519* probably null Het
Apol8 C T 15: 77,750,136 R80H probably benign Het
Arhgap25 G T 6: 87,488,305 S118* probably null Het
Arhgap30 T A 1: 171,397,518 Y47* probably null Het
Arhgap42 C T 9: 9,011,433 D451N probably damaging Het
Cabp2 T A 19: 4,085,582 F91I probably damaging Het
Ccdc30 T C 4: 119,373,746 E108G probably benign Het
Cfap99 T C 5: 34,301,419 S53P probably damaging Het
Clec5a C T 6: 40,579,427 R135H possibly damaging Het
Cops8 T G 1: 90,603,603 D18E probably benign Het
Cped1 A T 6: 22,233,481 M779L possibly damaging Het
Cyp4x1 G A 4: 115,110,066 H438Y probably damaging Het
Disc1 A T 8: 125,088,275 T293S probably benign Het
Ercc1 T C 7: 19,350,177 L113S probably damaging Het
Ermp1 G T 19: 29,615,796 N765K probably benign Het
Fam83c A G 2: 155,834,820 I10T probably benign Het
Farp1 T C 14: 121,275,596 V788A probably benign Het
Fbn1 C G 2: 125,477,569 G92R probably damaging Het
Fsd1 T A 17: 55,995,881 M328K probably benign Het
Fzd3 C A 14: 65,202,813 S636I probably benign Het
Gapvd1 A G 2: 34,704,318 S886P probably damaging Het
Gatad2b T A 3: 90,341,722 D22E probably benign Het
Gm10436 T C 12: 88,177,080 Y329C probably benign Het
Gm7168 A T 17: 13,948,976 K202* probably null Het
Gmps T C 3: 63,980,269 I54T probably damaging Het
Gp6 A G 7: 4,394,115 I107T probably benign Het
Gpat2 T C 2: 127,431,347 V217A possibly damaging Het
Hdlbp T A 1: 93,417,195 I863F probably damaging Het
Hmcn1 A C 1: 150,749,090 I1021M possibly damaging Het
Igkv6-14 C T 6: 70,435,103 A66T probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqch A G 9: 63,454,573 I925T probably benign Het
Kcnt1 A G 2: 25,901,211 E522G possibly damaging Het
Kremen2 C G 17: 23,743,802 E103D probably damaging Het
Lig4 G T 8: 9,973,485 N98K probably benign Het
Lrrc3b T G 14: 15,358,232 I125L probably benign Het
Lrrc4 T C 6: 28,829,903 D148G probably damaging Het
Lrsam1 A G 2: 32,947,889 Y218H possibly damaging Het
Mmrn2 G A 14: 34,397,636 V191I probably benign Het
Nadk T A 4: 155,570,670 probably null Het
Napb C A 2: 148,709,431 A61S possibly damaging Het
Ncan T A 8: 70,108,571 D582V possibly damaging Het
Ncl T C 1: 86,356,642 D244G possibly damaging Het
Nlrp14 A G 7: 107,192,508 N800S possibly damaging Het
Nlrp9b C T 7: 20,019,335 T55M probably benign Het
Nobox G A 6: 43,306,017 T228I probably benign Het
Npffr1 C A 10: 61,613,971 P8H possibly damaging Het
Nrg2 T C 18: 36,021,103 Y587C probably damaging Het
Nsd1 T G 13: 55,245,621 V448G probably benign Het
Olfr1016 A G 2: 85,799,667 L201P probably damaging Het
Olfr228 T G 2: 86,483,068 I225L probably damaging Het
Olfr263 T A 13: 21,133,201 V142D probably benign Het
Olfr513 G T 7: 108,755,231 C125F probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Ppp5c T C 7: 17,009,007 T229A probably benign Het
Prr5 C T 15: 84,693,792 R101C probably damaging Het
Psg22 T C 7: 18,723,062 M290T probably benign Het
Pzp C T 6: 128,513,731 probably null Het
Rapgef6 T C 11: 54,625,958 V347A probably benign Het
Rttn A T 18: 89,010,916 H586L probably damaging Het
Sema3f A T 9: 107,688,076 I259K possibly damaging Het
Sgpp1 A T 12: 75,716,600 L269Q probably damaging Het
Slc22a8 A C 19: 8,605,539 I195L probably benign Het
Slc35a5 T C 16: 45,142,188 T425A unknown Het
Stard13 G A 5: 151,063,505 T180I probably damaging Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svil A T 18: 5,062,385 T902S probably damaging Het
Tnfaip8l3 T A 9: 54,027,137 R185W probably damaging Het
Ttn A T 2: 76,760,049 D21105E probably benign Het
Vmn2r109 T A 17: 20,554,467 M209L probably benign Het
Vmn2r125 A G 4: 156,351,347 H340R probably damaging Het
Zfp946 T C 17: 22,455,500 C412R probably damaging Het
Other mutations in Gm30302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6813:Gm30302 UTSW 13 49787396 missense probably benign 0.03
R7638:Gm30302 UTSW 13 49786975 missense probably benign 0.02
R7881:Gm30302 UTSW 13 49790071 missense possibly damaging 0.83
R8097:Gm30302 UTSW 13 49790200 start codon destroyed probably benign 0.02
R8414:Gm30302 UTSW 13 49787797 missense probably damaging 1.00
Z1176:Gm30302 UTSW 13 49785384 missense possibly damaging 0.90
Z1176:Gm30302 UTSW 13 49786462 missense possibly damaging 0.79
Z1176:Gm30302 UTSW 13 49787848 missense probably damaging 1.00
Z1177:Gm30302 UTSW 13 49787175 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGGCTTCTGGCTCTGAATC -3'
(R):5'- ATAGCAATCCCAGAGCCTCTG -3'

Sequencing Primer
(F):5'- TGGCTCTGAATCTCATAAAATCCC -3'
(R):5'- GAGCCTCTGAATCTGCCAATAG -3'
Posted On2020-06-30