Incidental Mutation 'R0704:Nrbp2'
ID63103
Institutional Source Beutler Lab
Gene Symbol Nrbp2
Ensembl Gene ENSMUSG00000075590
Gene Namenuclear receptor binding protein 2
Synonyms
MMRRC Submission 038887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0704 (G1)
Quality Score126
Status Not validated
Chromosome15
Chromosomal Location76085518-76091627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76088952 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 294 (S294P)
Ref Sequence ENSEMBL: ENSMUSP00000154287 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000019516
AA Change: S53P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226356
Predicted Effect probably benign
Transcript: ENSMUST00000226444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227183
Predicted Effect probably benign
Transcript: ENSMUST00000227605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228022
Predicted Effect probably damaging
Transcript: ENSMUST00000228366
AA Change: S294P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000228419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228431
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,210,083 V1256A possibly damaging Het
4930433I11Rik T A 7: 40,993,957 L441Q probably damaging Het
Abca15 A T 7: 120,354,523 E550V probably damaging Het
Adcy4 A G 14: 55,772,756 F690L probably benign Het
Aspg T A 12: 112,114,472 N132K probably damaging Het
B430305J03Rik A T 3: 61,363,993 Y110* probably null Het
Cep135 A G 5: 76,630,949 E741G possibly damaging Het
Dkkl1 T C 7: 45,210,115 K128E probably damaging Het
Duox2 A T 2: 122,284,768 M1101K probably benign Het
Gpr89 T C 3: 96,880,168 probably null Het
Hormad1 T C 3: 95,566,686 probably null Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Itga2 A G 13: 114,862,375 F658S possibly damaging Het
Kcnc4 T C 3: 107,447,963 I390V possibly damaging Het
Krt84 G T 15: 101,532,677 H27N probably benign Het
Lama5 A G 2: 180,179,484 I3095T possibly damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Ms4a1 T C 19: 11,253,232 T202A probably benign Het
Olfr524 A G 7: 140,202,635 V45A probably benign Het
Olfr811 A G 10: 129,802,303 V74A probably benign Het
Pde4b C T 4: 102,487,392 L155F probably damaging Het
Pds5a A G 5: 65,620,585 S6P probably damaging Het
Ralgapa2 A T 2: 146,451,784 L150Q probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Rgs12 T G 5: 35,023,122 S253A possibly damaging Het
Sap130 C A 18: 31,653,554 T266K probably damaging Het
Sis T C 3: 72,949,822 I379V possibly damaging Het
Slc39a10 T A 1: 46,835,861 I94F possibly damaging Het
Sptb A T 12: 76,583,594 N2263K probably damaging Het
Srsf12 A G 4: 33,231,069 R188G probably damaging Het
Ssxb9 T G X: 8,371,783 S130R probably damaging Het
Tg A G 15: 66,757,880 D470G probably benign Het
Urb1 T C 16: 90,776,207 Q979R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp78 T A 7: 6,379,252 C402S probably damaging Het
Other mutations in Nrbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02890:Nrbp2 APN 15 76089457 missense probably damaging 1.00
PIT4377001:Nrbp2 UTSW 15 76087096 missense probably benign 0.00
R0513:Nrbp2 UTSW 15 76088976 missense probably benign 0.05
R5748:Nrbp2 UTSW 15 76089483 missense probably damaging 1.00
R6848:Nrbp2 UTSW 15 76091483 unclassified probably benign
R7634:Nrbp2 UTSW 15 76087408 missense possibly damaging 0.79
R7699:Nrbp2 UTSW 15 76090897 missense probably damaging 1.00
R7700:Nrbp2 UTSW 15 76090897 missense probably damaging 1.00
Z1177:Nrbp2 UTSW 15 76090255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTGTGAACGACACAAGTGCTC -3'
(R):5'- GCTGCTAATGGGATGACTTCTCTGC -3'

Sequencing Primer
(F):5'- TCATGGGGATGGACCCAAC -3'
(R):5'- TGCTCATTCATACAGGAAGGCTC -3'
Posted On2013-07-30