Incidental Mutation 'R8113:Vmn2r109'
ID 631033
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8113 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20554467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 209 (M209L)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: M209L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: M209L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,321,803 S625P probably damaging Het
Agpat1 T C 17: 34,611,612 V170A probably damaging Het
Alg9 C T 9: 50,808,780 Q519* probably null Het
Apol8 C T 15: 77,750,136 R80H probably benign Het
Arhgap25 G T 6: 87,488,305 S118* probably null Het
Arhgap30 T A 1: 171,397,518 Y47* probably null Het
Arhgap42 C T 9: 9,011,433 D451N probably damaging Het
Cabp2 T A 19: 4,085,582 F91I probably damaging Het
Ccdc30 T C 4: 119,373,746 E108G probably benign Het
Cfap99 T C 5: 34,301,419 S53P probably damaging Het
Clec5a C T 6: 40,579,427 R135H possibly damaging Het
Cops8 T G 1: 90,603,603 D18E probably benign Het
Cped1 A T 6: 22,233,481 M779L possibly damaging Het
Cyp4x1 G A 4: 115,110,066 H438Y probably damaging Het
Disc1 A T 8: 125,088,275 T293S probably benign Het
Ercc1 T C 7: 19,350,177 L113S probably damaging Het
Ermp1 G T 19: 29,615,796 N765K probably benign Het
Fam83c A G 2: 155,834,820 I10T probably benign Het
Farp1 T C 14: 121,275,596 V788A probably benign Het
Fbn1 C G 2: 125,477,569 G92R probably damaging Het
Fsd1 T A 17: 55,995,881 M328K probably benign Het
Fzd3 C A 14: 65,202,813 S636I probably benign Het
Gapvd1 A G 2: 34,704,318 S886P probably damaging Het
Gatad2b T A 3: 90,341,722 D22E probably benign Het
Gm10436 T C 12: 88,177,080 Y329C probably benign Het
Gm30302 G A 13: 49,786,072 R721C probably benign Het
Gm7168 A T 17: 13,948,976 K202* probably null Het
Gmps T C 3: 63,980,269 I54T probably damaging Het
Gp6 A G 7: 4,394,115 I107T probably benign Het
Gpat2 T C 2: 127,431,347 V217A possibly damaging Het
Hdlbp T A 1: 93,417,195 I863F probably damaging Het
Hmcn1 A C 1: 150,749,090 I1021M possibly damaging Het
Igkv6-14 C T 6: 70,435,103 A66T probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqch A G 9: 63,454,573 I925T probably benign Het
Kcnt1 A G 2: 25,901,211 E522G possibly damaging Het
Kremen2 C G 17: 23,743,802 E103D probably damaging Het
Lig4 G T 8: 9,973,485 N98K probably benign Het
Lrrc3b T G 14: 15,358,232 I125L probably benign Het
Lrrc4 T C 6: 28,829,903 D148G probably damaging Het
Lrsam1 A G 2: 32,947,889 Y218H possibly damaging Het
Mmrn2 G A 14: 34,397,636 V191I probably benign Het
Nadk T A 4: 155,570,670 probably null Het
Napb C A 2: 148,709,431 A61S possibly damaging Het
Ncan T A 8: 70,108,571 D582V possibly damaging Het
Ncl T C 1: 86,356,642 D244G possibly damaging Het
Nlrp14 A G 7: 107,192,508 N800S possibly damaging Het
Nlrp9b C T 7: 20,019,335 T55M probably benign Het
Nobox G A 6: 43,306,017 T228I probably benign Het
Npffr1 C A 10: 61,613,971 P8H possibly damaging Het
Nrg2 T C 18: 36,021,103 Y587C probably damaging Het
Nsd1 T G 13: 55,245,621 V448G probably benign Het
Olfr1016 A G 2: 85,799,667 L201P probably damaging Het
Olfr228 T G 2: 86,483,068 I225L probably damaging Het
Olfr263 T A 13: 21,133,201 V142D probably benign Het
Olfr513 G T 7: 108,755,231 C125F probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Ppp5c T C 7: 17,009,007 T229A probably benign Het
Prr5 C T 15: 84,693,792 R101C probably damaging Het
Psg22 T C 7: 18,723,062 M290T probably benign Het
Pzp C T 6: 128,513,731 probably null Het
Rapgef6 T C 11: 54,625,958 V347A probably benign Het
Rttn A T 18: 89,010,916 H586L probably damaging Het
Sema3f A T 9: 107,688,076 I259K possibly damaging Het
Sgpp1 A T 12: 75,716,600 L269Q probably damaging Het
Slc22a8 A C 19: 8,605,539 I195L probably benign Het
Slc35a5 T C 16: 45,142,188 T425A unknown Het
Stard13 G A 5: 151,063,505 T180I probably damaging Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svil A T 18: 5,062,385 T902S probably damaging Het
Tnfaip8l3 T A 9: 54,027,137 R185W probably damaging Het
Ttn A T 2: 76,760,049 D21105E probably benign Het
Vmn2r125 A G 4: 156,351,347 H340R probably damaging Het
Zfp946 T C 17: 22,455,500 C412R probably damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTATGAGAGAATCAATGTCACC -3'
(R):5'- CAGGTTTGGCAGGAATTTCTGTAC -3'

Sequencing Primer
(F):5'- ATTTGTCTCATCCATATTTTCCCAG -3'
(R):5'- TGGCAGGAATTTCTGTACAATTC -3'
Posted On 2020-06-30