Incidental Mutation 'R8113:Vmn2r109'
ID 631033
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 067542-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8113 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20760779-20785018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20774729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 209 (M209L)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: M209L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: M209L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (72/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 89,048,431 (GRCm39) S625P probably damaging Het
Agpat1 T C 17: 34,830,586 (GRCm39) V170A probably damaging Het
Alg9 C T 9: 50,720,080 (GRCm39) Q519* probably null Het
Apol8 C T 15: 77,634,336 (GRCm39) R80H probably benign Het
Arhgap25 G T 6: 87,465,287 (GRCm39) S118* probably null Het
Arhgap30 T A 1: 171,225,086 (GRCm39) Y47* probably null Het
Arhgap42 C T 9: 9,011,434 (GRCm39) D451N probably damaging Het
Cabp2 T A 19: 4,135,582 (GRCm39) F91I probably damaging Het
Ccdc30 T C 4: 119,230,943 (GRCm39) E108G probably benign Het
Cfap99 T C 5: 34,458,763 (GRCm39) S53P probably damaging Het
Clec5a C T 6: 40,556,361 (GRCm39) R135H possibly damaging Het
Cops8 T G 1: 90,531,325 (GRCm39) D18E probably benign Het
Cped1 A T 6: 22,233,480 (GRCm39) M779L possibly damaging Het
Cyp4x1 G A 4: 114,967,263 (GRCm39) H438Y probably damaging Het
Disc1 A T 8: 125,815,014 (GRCm39) T293S probably benign Het
Ercc1 T C 7: 19,084,102 (GRCm39) L113S probably damaging Het
Ermp1 G T 19: 29,593,196 (GRCm39) N765K probably benign Het
Fam83c A G 2: 155,676,740 (GRCm39) I10T probably benign Het
Farp1 T C 14: 121,513,008 (GRCm39) V788A probably benign Het
Fbn1 C G 2: 125,319,489 (GRCm39) G92R probably damaging Het
Fsd1 T A 17: 56,302,881 (GRCm39) M328K probably benign Het
Fzd3 C A 14: 65,440,262 (GRCm39) S636I probably benign Het
Gapvd1 A G 2: 34,594,330 (GRCm39) S886P probably damaging Het
Gatad2b T A 3: 90,249,029 (GRCm39) D22E probably benign Het
Gm7168 A T 17: 14,169,238 (GRCm39) K202* probably null Het
Gmps T C 3: 63,887,690 (GRCm39) I54T probably damaging Het
Gp6 A G 7: 4,397,114 (GRCm39) I107T probably benign Het
Gpat2 T C 2: 127,273,267 (GRCm39) V217A possibly damaging Het
Hdlbp T A 1: 93,344,917 (GRCm39) I863F probably damaging Het
Hmcn1 A C 1: 150,624,841 (GRCm39) I1021M possibly damaging Het
Igkv6-14 C T 6: 70,412,087 (GRCm39) A66T probably benign Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Iqch A G 9: 63,361,855 (GRCm39) I925T probably benign Het
Kcnt1 A G 2: 25,791,223 (GRCm39) E522G possibly damaging Het
Kremen2 C G 17: 23,962,776 (GRCm39) E103D probably damaging Het
Lig4 G T 8: 10,023,485 (GRCm39) N98K probably benign Het
Lrrc3b T G 14: 15,358,232 (GRCm38) I125L probably benign Het
Lrrc4 T C 6: 28,829,902 (GRCm39) D148G probably damaging Het
Lrsam1 A G 2: 32,837,901 (GRCm39) Y218H possibly damaging Het
Mmrn2 G A 14: 34,119,593 (GRCm39) V191I probably benign Het
Nadk T A 4: 155,655,127 (GRCm39) probably null Het
Napb C A 2: 148,551,351 (GRCm39) A61S possibly damaging Het
Ncan T A 8: 70,561,221 (GRCm39) D582V possibly damaging Het
Ncl T C 1: 86,284,364 (GRCm39) D244G possibly damaging Het
Nlrp14 A G 7: 106,791,715 (GRCm39) N800S possibly damaging Het
Nlrp9b C T 7: 19,753,260 (GRCm39) T55M probably benign Het
Nobox G A 6: 43,282,951 (GRCm39) T228I probably benign Het
Npffr1 C A 10: 61,449,750 (GRCm39) P8H possibly damaging Het
Nrg2 T C 18: 36,154,156 (GRCm39) Y587C probably damaging Het
Nsd1 T G 13: 55,393,434 (GRCm39) V448G probably benign Het
Or2w1 T A 13: 21,317,371 (GRCm39) V142D probably benign Het
Or5e1 G T 7: 108,354,438 (GRCm39) C125F probably damaging Het
Or8k41 T G 2: 86,313,412 (GRCm39) I225L probably damaging Het
Or9g20 A G 2: 85,630,011 (GRCm39) L201P probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Ppp5c T C 7: 16,742,932 (GRCm39) T229A probably benign Het
Pramel51 T C 12: 88,143,850 (GRCm39) Y329C probably benign Het
Prr5 C T 15: 84,577,993 (GRCm39) R101C probably damaging Het
Psg22 T C 7: 18,456,987 (GRCm39) M290T probably benign Het
Pzp C T 6: 128,490,694 (GRCm39) probably null Het
Rapgef6 T C 11: 54,516,784 (GRCm39) V347A probably benign Het
Rttn A T 18: 89,029,040 (GRCm39) H586L probably damaging Het
Sema3f A T 9: 107,565,275 (GRCm39) I259K possibly damaging Het
Sgpp1 A T 12: 75,763,374 (GRCm39) L269Q probably damaging Het
Slc22a8 A C 19: 8,582,903 (GRCm39) I195L probably benign Het
Slc35a5 T C 16: 44,962,551 (GRCm39) T425A unknown Het
Spata31e1 G A 13: 49,939,548 (GRCm39) R721C probably benign Het
Stard13 G A 5: 150,986,970 (GRCm39) T180I probably damaging Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svil A T 18: 5,062,385 (GRCm39) T902S probably damaging Het
Tnfaip8l3 T A 9: 53,934,421 (GRCm39) R185W probably damaging Het
Ttn A T 2: 76,590,393 (GRCm39) D21105E probably benign Het
Vmn2r125 A G 4: 156,703,642 (GRCm39) H340R probably damaging Het
Zfp946 T C 17: 22,674,481 (GRCm39) C412R probably damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20,770,419 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20,761,383 (GRCm39) missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20,761,671 (GRCm39) missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20,774,654 (GRCm39) missense probably benign
IGL01864:Vmn2r109 APN 17 20,761,396 (GRCm39) missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20,761,342 (GRCm39) missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20,774,603 (GRCm39) missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20,774,422 (GRCm39) missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20,761,150 (GRCm39) missense probably benign
IGL02490:Vmn2r109 APN 17 20,761,246 (GRCm39) missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20,760,963 (GRCm39) missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20,774,518 (GRCm39) missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20,774,062 (GRCm39) missense probably benign
IGL02745:Vmn2r109 APN 17 20,761,512 (GRCm39) missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20,774,839 (GRCm39) critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20,773,148 (GRCm39) missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20,760,937 (GRCm39) missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20,761,670 (GRCm39) nonsense probably null
R0882:Vmn2r109 UTSW 17 20,774,842 (GRCm39) splice site probably benign
R1241:Vmn2r109 UTSW 17 20,775,503 (GRCm39) missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20,761,002 (GRCm39) missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20,774,072 (GRCm39) nonsense probably null
R1957:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20,774,185 (GRCm39) missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20,761,448 (GRCm39) nonsense probably null
R2073:Vmn2r109 UTSW 17 20,784,974 (GRCm39) missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20,774,798 (GRCm39) missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20,761,248 (GRCm39) missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20,774,704 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20,774,074 (GRCm39) missense probably benign
R4428:Vmn2r109 UTSW 17 20,773,286 (GRCm39) missense probably benign
R4584:Vmn2r109 UTSW 17 20,774,820 (GRCm39) nonsense probably null
R4652:Vmn2r109 UTSW 17 20,761,656 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20,761,605 (GRCm39) missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20,774,153 (GRCm39) missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20,761,494 (GRCm39) missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20,770,348 (GRCm39) missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20,775,451 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20,774,603 (GRCm39) missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20,761,189 (GRCm39) missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20,760,933 (GRCm39) missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20,760,781 (GRCm39) makesense probably null
R5702:Vmn2r109 UTSW 17 20,774,407 (GRCm39) missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20,774,567 (GRCm39) missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20,773,121 (GRCm39) missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20,761,318 (GRCm39) missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20,760,981 (GRCm39) missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20,761,440 (GRCm39) missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20,784,796 (GRCm39) critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20,774,785 (GRCm39) missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20,760,932 (GRCm39) missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20,760,973 (GRCm39) missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20,785,006 (GRCm39) missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20,761,225 (GRCm39) missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20,760,945 (GRCm39) missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20,761,700 (GRCm39) missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20,761,043 (GRCm39) missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20,761,536 (GRCm39) missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20,774,665 (GRCm39) missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20,760,942 (GRCm39) missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20,773,117 (GRCm39) missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20,761,436 (GRCm39) missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20,760,782 (GRCm39) missense probably benign 0.08
R8153:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20,774,531 (GRCm39) missense possibly damaging 0.96
R9687:Vmn2r109 UTSW 17 20,775,332 (GRCm39) missense
Z1176:Vmn2r109 UTSW 17 20,773,256 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCTATGAGAGAATCAATGTCACC -3'
(R):5'- CAGGTTTGGCAGGAATTTCTGTAC -3'

Sequencing Primer
(F):5'- ATTTGTCTCATCCATATTTTCCCAG -3'
(R):5'- TGGCAGGAATTTCTGTACAATTC -3'
Posted On 2020-06-30