Incidental Mutation 'R8114:Rbm47'
ID631056
Institutional Source Beutler Lab
Gene Symbol Rbm47
Ensembl Gene ENSMUSG00000070780
Gene NameRNA binding motif protein 47
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R8114 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location66016549-66173118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66026853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 136 (I136V)
Ref Sequence ENSEMBL: ENSMUSP00000092349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094756] [ENSMUST00000094757] [ENSMUST00000113724] [ENSMUST00000113726] [ENSMUST00000167950] [ENSMUST00000200775] [ENSMUST00000200852] [ENSMUST00000201544] [ENSMUST00000201561] [ENSMUST00000202700]
Predicted Effect probably benign
Transcript: ENSMUST00000094756
AA Change: I136V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000092348
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094757
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092349
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113724
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109353
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113726
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109355
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167950
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128016
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200775
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144325
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200852
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144505
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201544
AA Change: I136V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144122
Gene: ENSMUSG00000070780
AA Change: I136V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201561
Predicted Effect probably benign
Transcript: ENSMUST00000202700
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.7%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit partial prenatal lethality. Surviving adults are small and display impaired cytidine to uridine RNA editing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,934,657 T22A probably benign Het
A630010A05Rik G T 16: 14,589,227 E7* probably null Het
Abca7 T C 10: 80,009,040 I1532T probably damaging Het
Adam12 T C 7: 133,967,888 D286G probably damaging Het
Ahnak2 T C 12: 112,774,729 T970A probably benign Het
Apcdd1 A G 18: 62,950,056 N319S probably damaging Het
Arih1 A G 9: 59,396,553 M423T probably benign Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Ccdc110 A T 8: 45,943,103 Q677L probably damaging Het
Ccdc171 A G 4: 83,696,300 N1046S probably damaging Het
Ccdc63 G T 5: 122,113,181 Q389K possibly damaging Het
Cd274 T C 19: 29,384,128 S279P probably damaging Het
Cdcp2 A T 4: 107,105,358 I243F probably damaging Het
Cul2 A T 18: 3,426,164 K414* probably null Het
Daglb A G 5: 143,478,463 H243R probably benign Het
Dnah5 A T 15: 28,239,976 Y493F probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eea1 G T 10: 95,994,989 E171* probably null Het
Eml6 C T 11: 29,754,910 G1545R probably damaging Het
Epg5 A G 18: 78,030,150 I2463V probably benign Het
Fgl1 A G 8: 41,191,583 Y295H probably damaging Het
Frrs1 A G 3: 116,881,776 T118A probably damaging Het
Gdi2 T C 13: 3,548,906 V30A probably damaging Het
Gm6583 C A 5: 112,355,697 R47L probably benign Het
Ints4 A G 7: 97,516,525 probably null Het
Iqsec3 A G 6: 121,413,499 S338P unknown Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Ldah A G 12: 8,284,039 E310G probably damaging Het
Mtnr1b A G 9: 15,874,267 V65A probably damaging Het
Myo7b G T 18: 31,965,624 T1735K probably damaging Het
Neb A T 2: 52,325,722 V191D possibly damaging Het
Oas1e T C 5: 120,786,643 T377A unknown Het
Olfr1055 A T 2: 86,347,186 H193Q probably benign Het
Olfr122 T C 17: 37,771,989 F112S possibly damaging Het
Olfr1418 G A 19: 11,855,102 P284S probably damaging Het
Platr25 T C 13: 62,673,924 S70G possibly damaging Het
Plcl2 T C 17: 50,687,787 S1095P probably damaging Het
Polq A G 16: 37,042,215 K637E possibly damaging Het
Serpinb3c A C 1: 107,276,304 N59K probably benign Het
Shcbp1 T A 8: 4,767,930 N122Y probably damaging Het
Sim2 T C 16: 94,122,644 V347A probably benign Het
Slc22a30 A T 19: 8,404,540 Y122* probably null Het
Slc34a2 G A 5: 53,068,359 S450N probably benign Het
Snx17 A T 5: 31,197,702 M354L probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Surf6 G A 2: 26,892,368 Q316* probably null Het
Tiprl A G 1: 165,228,422 S44P probably benign Het
Tmem39a C A 16: 38,590,996 L438M probably damaging Het
Tmem39a T G 16: 38,590,997 L438R probably damaging Het
Tns2 G C 15: 102,111,390 V572L probably benign Het
Trdn T C 10: 33,083,628 probably benign Het
Trpc7 T C 13: 56,804,598 I587V probably benign Het
Usp47 A G 7: 112,093,187 D952G probably damaging Het
Vmn2r58 A T 7: 41,861,968 N470K probably damaging Het
Vmn2r67 A T 7: 85,155,889 I5N probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ythdc2 A G 18: 44,877,740 D1272G probably benign Het
Zfp959 A G 17: 55,898,496 Y511C probably benign Het
Other mutations in Rbm47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Rbm47 APN 5 66026738 missense possibly damaging 0.75
IGL01648:Rbm47 APN 5 66024978 missense possibly damaging 0.59
IGL02323:Rbm47 APN 5 66026429 missense probably damaging 1.00
IGL02456:Rbm47 APN 5 66027021 missense probably damaging 1.00
IGL03329:Rbm47 APN 5 66026693 missense probably damaging 0.98
PIT4402001:Rbm47 UTSW 5 66027011 missense probably damaging 1.00
R0131:Rbm47 UTSW 5 66026529 missense possibly damaging 0.86
R1575:Rbm47 UTSW 5 66025015 missense probably benign 0.00
R1587:Rbm47 UTSW 5 66024991 missense probably benign 0.23
R1645:Rbm47 UTSW 5 66027138 missense probably benign 0.44
R1750:Rbm47 UTSW 5 66019310 missense possibly damaging 0.78
R4085:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4087:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4090:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4280:Rbm47 UTSW 5 66026177 missense probably damaging 1.00
R4714:Rbm47 UTSW 5 66025052 missense probably damaging 1.00
R4744:Rbm47 UTSW 5 66026693 missense probably damaging 0.98
R4807:Rbm47 UTSW 5 66019304 missense possibly damaging 0.71
R5453:Rbm47 UTSW 5 66027182 missense probably benign 0.07
R6090:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6091:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6136:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6137:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6159:Rbm47 UTSW 5 66026816 missense probably damaging 0.99
R6181:Rbm47 UTSW 5 66026490 missense possibly damaging 0.92
R6425:Rbm47 UTSW 5 66022816 missense probably damaging 1.00
R7292:Rbm47 UTSW 5 66026750 missense possibly damaging 0.86
R7332:Rbm47 UTSW 5 66026214 missense probably damaging 1.00
R7405:Rbm47 UTSW 5 66026495 missense probably damaging 0.98
R8348:Rbm47 UTSW 5 66027230 missense possibly damaging 0.60
Z1176:Rbm47 UTSW 5 66022672 missense probably benign 0.04
Z1176:Rbm47 UTSW 5 66026979 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CACGATGGCTCTCATACTCC -3'
(R):5'- AGGTCTTCGTGGGCAAGATC -3'

Sequencing Primer
(F):5'- GATGGCTCTCATACTCCACAAAGG -3'
(R):5'- GCAAGATCCCACGTGACG -3'
Posted On2020-06-30