Incidental Mutation 'R8114:Vmn2r58'
ID631062
Institutional Source Beutler Lab
Gene Symbol Vmn2r58
Ensembl Gene ENSMUSG00000090383
Gene Namevomeronasal 2, receptor 58
SynonymsEG628422
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R8114 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location41836881-41872670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41861968 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 470 (N470K)
Ref Sequence ENSEMBL: ENSMUSP00000126966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171671]
Predicted Effect probably damaging
Transcript: ENSMUST00000171671
AA Change: N470K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126966
Gene: ENSMUSG00000090383
AA Change: N470K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 8e-43 PFAM
Pfam:NCD3G 514 567 1.8e-23 PFAM
Pfam:7tm_3 597 835 2.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,934,657 T22A probably benign Het
A630010A05Rik G T 16: 14,589,227 E7* probably null Het
Abca7 T C 10: 80,009,040 I1532T probably damaging Het
Adam12 T C 7: 133,967,888 D286G probably damaging Het
Ahnak2 T C 12: 112,774,729 T970A probably benign Het
Apcdd1 A G 18: 62,950,056 N319S probably damaging Het
Arih1 A G 9: 59,396,553 M423T probably benign Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Ccdc110 A T 8: 45,943,103 Q677L probably damaging Het
Ccdc171 A G 4: 83,696,300 N1046S probably damaging Het
Ccdc63 G T 5: 122,113,181 Q389K possibly damaging Het
Cd274 T C 19: 29,384,128 S279P probably damaging Het
Cdcp2 A T 4: 107,105,358 I243F probably damaging Het
Cul2 A T 18: 3,426,164 K414* probably null Het
Daglb A G 5: 143,478,463 H243R probably benign Het
Dnah5 A T 15: 28,239,976 Y493F probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eea1 G T 10: 95,994,989 E171* probably null Het
Eml6 C T 11: 29,754,910 G1545R probably damaging Het
Epg5 A G 18: 78,030,150 I2463V probably benign Het
Fgl1 A G 8: 41,191,583 Y295H probably damaging Het
Frrs1 A G 3: 116,881,776 T118A probably damaging Het
Gdi2 T C 13: 3,548,906 V30A probably damaging Het
Gm6583 C A 5: 112,355,697 R47L probably benign Het
Ints4 A G 7: 97,516,525 probably null Het
Iqsec3 A G 6: 121,413,499 S338P unknown Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Ldah A G 12: 8,284,039 E310G probably damaging Het
Mtnr1b A G 9: 15,874,267 V65A probably damaging Het
Myo7b G T 18: 31,965,624 T1735K probably damaging Het
Neb A T 2: 52,325,722 V191D possibly damaging Het
Oas1e T C 5: 120,786,643 T377A unknown Het
Olfr1055 A T 2: 86,347,186 H193Q probably benign Het
Olfr122 T C 17: 37,771,989 F112S possibly damaging Het
Olfr1418 G A 19: 11,855,102 P284S probably damaging Het
Platr25 T C 13: 62,673,924 S70G possibly damaging Het
Plcl2 T C 17: 50,687,787 S1095P probably damaging Het
Polq A G 16: 37,042,215 K637E possibly damaging Het
Rbm47 T C 5: 66,026,853 I136V probably benign Het
Serpinb3c A C 1: 107,276,304 N59K probably benign Het
Shcbp1 T A 8: 4,767,930 N122Y probably damaging Het
Sim2 T C 16: 94,122,644 V347A probably benign Het
Slc22a30 A T 19: 8,404,540 Y122* probably null Het
Slc34a2 G A 5: 53,068,359 S450N probably benign Het
Snx17 A T 5: 31,197,702 M354L probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Surf6 G A 2: 26,892,368 Q316* probably null Het
Tiprl A G 1: 165,228,422 S44P probably benign Het
Tmem39a C A 16: 38,590,996 L438M probably damaging Het
Tmem39a T G 16: 38,590,997 L438R probably damaging Het
Tns2 G C 15: 102,111,390 V572L probably benign Het
Trdn T C 10: 33,083,628 probably benign Het
Trpc7 T C 13: 56,804,598 I587V probably benign Het
Usp47 A G 7: 112,093,187 D952G probably damaging Het
Vmn2r67 A T 7: 85,155,889 I5N probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ythdc2 A G 18: 44,877,740 D1272G probably benign Het
Zfp959 A G 17: 55,898,496 Y511C probably benign Het
Other mutations in Vmn2r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn2r58 APN 7 41864430 missense possibly damaging 0.53
IGL00924:Vmn2r58 APN 7 41837467 missense probably damaging 1.00
IGL01291:Vmn2r58 APN 7 41864511 missense probably benign 0.02
IGL01480:Vmn2r58 APN 7 41864692 missense probably benign 0.01
IGL01551:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL01591:Vmn2r58 APN 7 41865329 missense probably benign 0.03
IGL01940:Vmn2r58 APN 7 41837647 missense probably benign 0.00
IGL01994:Vmn2r58 APN 7 41836970 missense probably damaging 0.98
IGL02041:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL02222:Vmn2r58 APN 7 41864025 missense possibly damaging 0.81
IGL02317:Vmn2r58 APN 7 41837341 missense possibly damaging 0.89
IGL02614:Vmn2r58 APN 7 41837129 missense probably damaging 1.00
IGL02673:Vmn2r58 APN 7 41864658 missense possibly damaging 0.90
IGL03323:Vmn2r58 APN 7 41861871 missense probably benign 0.06
IGL03337:Vmn2r58 APN 7 41864386 missense possibly damaging 0.93
IGL03380:Vmn2r58 APN 7 41864450 missense probably benign 0.00
ANU05:Vmn2r58 UTSW 7 41864511 missense probably benign 0.02
R0138:Vmn2r58 UTSW 7 41837624 missense probably damaging 1.00
R0141:Vmn2r58 UTSW 7 41861885 missense probably benign 0.11
R0421:Vmn2r58 UTSW 7 41865204 missense probably benign 0.02
R0604:Vmn2r58 UTSW 7 41860576 missense possibly damaging 0.78
R0854:Vmn2r58 UTSW 7 41837138 missense probably damaging 1.00
R1413:Vmn2r58 UTSW 7 41863963 missense probably benign 0.01
R1441:Vmn2r58 UTSW 7 41837440 missense probably damaging 1.00
R1678:Vmn2r58 UTSW 7 41864056 missense probably benign 0.40
R1691:Vmn2r58 UTSW 7 41837489 missense possibly damaging 0.95
R1699:Vmn2r58 UTSW 7 41860527 missense probably benign
R1865:Vmn2r58 UTSW 7 41837258 missense possibly damaging 0.95
R2008:Vmn2r58 UTSW 7 41860500 missense probably damaging 1.00
R2036:Vmn2r58 UTSW 7 41863993 missense probably benign
R2202:Vmn2r58 UTSW 7 41864170 missense probably benign 0.07
R3787:Vmn2r58 UTSW 7 41864074 missense probably benign 0.01
R3883:Vmn2r58 UTSW 7 41864490 nonsense probably null
R3944:Vmn2r58 UTSW 7 41864461 missense probably benign 0.03
R3949:Vmn2r58 UTSW 7 41863924 missense probably benign 0.08
R4232:Vmn2r58 UTSW 7 41837587 missense possibly damaging 0.91
R4409:Vmn2r58 UTSW 7 41872627 missense possibly damaging 0.69
R4411:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4413:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4600:Vmn2r58 UTSW 7 41872622 missense probably benign 0.03
R4610:Vmn2r58 UTSW 7 41837693 missense probably benign
R4646:Vmn2r58 UTSW 7 41860511 missense probably damaging 0.96
R4793:Vmn2r58 UTSW 7 41865071 missense probably damaging 0.99
R4870:Vmn2r58 UTSW 7 41837215 missense possibly damaging 0.76
R4981:Vmn2r58 UTSW 7 41837461 missense probably damaging 1.00
R4993:Vmn2r58 UTSW 7 41837752 missense probably benign 0.00
R5024:Vmn2r58 UTSW 7 41864322 missense probably damaging 0.99
R5064:Vmn2r58 UTSW 7 41837110 missense probably damaging 0.99
R5330:Vmn2r58 UTSW 7 41863960 nonsense probably null
R5526:Vmn2r58 UTSW 7 41872645 missense probably benign 0.01
R5980:Vmn2r58 UTSW 7 41865056 missense possibly damaging 0.81
R6163:Vmn2r58 UTSW 7 41837401 missense probably benign 0.31
R6365:Vmn2r58 UTSW 7 41864183 missense probably benign 0.42
R6567:Vmn2r58 UTSW 7 41865249 missense probably benign 0.34
R6594:Vmn2r58 UTSW 7 41837111 missense possibly damaging 0.69
R6980:Vmn2r58 UTSW 7 41864238 missense possibly damaging 0.64
R7373:Vmn2r58 UTSW 7 41837788 missense probably damaging 1.00
R7458:Vmn2r58 UTSW 7 41837699 missense probably benign 0.06
R7630:Vmn2r58 UTSW 7 41864187 missense probably damaging 0.99
R7807:Vmn2r58 UTSW 7 41872486 missense probably benign 0.05
R8232:Vmn2r58 UTSW 7 41864652 missense probably damaging 0.97
R8313:Vmn2r58 UTSW 7 41872528 missense probably benign 0.01
RF006:Vmn2r58 UTSW 7 41836959 frame shift probably null
RF027:Vmn2r58 UTSW 7 41836959 frame shift probably null
Z1176:Vmn2r58 UTSW 7 41864365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTCAATGATCATGACATCCTGAG -3'
(R):5'- ACAGCTGTCCTGGCTTCATG -3'

Sequencing Primer
(F):5'- TGTAAACCCTGTAGGCCA -3'
(R):5'- TGGAAATGGCTGTTTCAAATGAG -3'
Posted On2020-06-30