Incidental Mutation 'R8114:Ahnak2'
ID631077
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8114 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112774729 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 970 (T970A)
Ref Sequence ENSEMBL: ENSMUSP00000122404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101010] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000101010
AA Change: T164A

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812
AA Change: T164A

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
AA Change: T970A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812
AA Change: T970A

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137195
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,934,657 T22A probably benign Het
A630010A05Rik G T 16: 14,589,227 E7* probably null Het
Abca7 T C 10: 80,009,040 I1532T probably damaging Het
Adam12 T C 7: 133,967,888 D286G probably damaging Het
Apcdd1 A G 18: 62,950,056 N319S probably damaging Het
Arih1 A G 9: 59,396,553 M423T probably benign Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Ccdc110 A T 8: 45,943,103 Q677L probably damaging Het
Ccdc171 A G 4: 83,696,300 N1046S probably damaging Het
Ccdc63 G T 5: 122,113,181 Q389K possibly damaging Het
Cd274 T C 19: 29,384,128 S279P probably damaging Het
Cdcp2 A T 4: 107,105,358 I243F probably damaging Het
Cul2 A T 18: 3,426,164 K414* probably null Het
Daglb A G 5: 143,478,463 H243R probably benign Het
Dnah5 A T 15: 28,239,976 Y493F probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eea1 G T 10: 95,994,989 E171* probably null Het
Eml6 C T 11: 29,754,910 G1545R probably damaging Het
Epg5 A G 18: 78,030,150 I2463V probably benign Het
Fgl1 A G 8: 41,191,583 Y295H probably damaging Het
Frrs1 A G 3: 116,881,776 T118A probably damaging Het
Gdi2 T C 13: 3,548,906 V30A probably damaging Het
Gm6583 C A 5: 112,355,697 R47L probably benign Het
Ints4 A G 7: 97,516,525 probably null Het
Iqsec3 A G 6: 121,413,499 S338P unknown Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Ldah A G 12: 8,284,039 E310G probably damaging Het
Mtnr1b A G 9: 15,874,267 V65A probably damaging Het
Myo7b G T 18: 31,965,624 T1735K probably damaging Het
Neb A T 2: 52,325,722 V191D possibly damaging Het
Oas1e T C 5: 120,786,643 T377A unknown Het
Olfr1055 A T 2: 86,347,186 H193Q probably benign Het
Olfr122 T C 17: 37,771,989 F112S possibly damaging Het
Olfr1418 G A 19: 11,855,102 P284S probably damaging Het
Platr25 T C 13: 62,673,924 S70G possibly damaging Het
Plcl2 T C 17: 50,687,787 S1095P probably damaging Het
Polq A G 16: 37,042,215 K637E possibly damaging Het
Rbm47 T C 5: 66,026,853 I136V probably benign Het
Serpinb3c A C 1: 107,276,304 N59K probably benign Het
Shcbp1 T A 8: 4,767,930 N122Y probably damaging Het
Sim2 T C 16: 94,122,644 V347A probably benign Het
Slc22a30 A T 19: 8,404,540 Y122* probably null Het
Slc34a2 G A 5: 53,068,359 S450N probably benign Het
Snx17 A T 5: 31,197,702 M354L probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Surf6 G A 2: 26,892,368 Q316* probably null Het
Tiprl A G 1: 165,228,422 S44P probably benign Het
Tmem39a C A 16: 38,590,996 L438M probably damaging Het
Tmem39a T G 16: 38,590,997 L438R probably damaging Het
Tns2 G C 15: 102,111,390 V572L probably benign Het
Trdn T C 10: 33,083,628 probably benign Het
Trpc7 T C 13: 56,804,598 I587V probably benign Het
Usp47 A G 7: 112,093,187 D952G probably damaging Het
Vmn2r58 A T 7: 41,861,968 N470K probably damaging Het
Vmn2r67 A T 7: 85,155,889 I5N probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ythdc2 A G 18: 44,877,740 D1272G probably benign Het
Zfp959 A G 17: 55,898,496 Y511C probably benign Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
R7508:Ahnak2 UTSW 12 112774405 missense possibly damaging 0.46
R7560:Ahnak2 UTSW 12 112779674 missense
R7611:Ahnak2 UTSW 12 112788129 missense
R7743:Ahnak2 UTSW 12 112784763 missense not run
R7762:Ahnak2 UTSW 12 112775680 missense probably benign 0.27
R7780:Ahnak2 UTSW 12 112782613 missense
R7930:Ahnak2 UTSW 12 112779125 missense
R7985:Ahnak2 UTSW 12 112778963 missense
R8122:Ahnak2 UTSW 12 112776076 missense possibly damaging 0.83
R8240:Ahnak2 UTSW 12 112774648 missense probably benign 0.03
R8289:Ahnak2 UTSW 12 112775808 missense possibly damaging 0.46
R8315:Ahnak2 UTSW 12 112781133 missense
Z1177:Ahnak2 UTSW 12 112781199 missense
Predicted Primers PCR Primer
(F):5'- ACCTTGGACTCAGGCACATG -3'
(R):5'- TTGGTTAGGTCCAAAACTGAGC -3'

Sequencing Primer
(F):5'- CTCCAAGGGGATGCTGATGAC -3'
(R):5'- AGGTCCAAAACTGAGCTTCCTTC -3'
Posted On2020-06-30