Incidental Mutation 'R8114:Platr25'
ID631081
Institutional Source Beutler Lab
Gene Symbol Platr25
Ensembl Gene ENSMUSG00000074863
Gene Namepluripotency associated transcript 25
SynonymsGm5665
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R8114 (G1)
Quality Score181.009
Status Validated
Chromosome13
Chromosomal Location62671784-62760709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62673924 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 70 (S70G)
Ref Sequence ENSEMBL: ENSMUSP00000152117 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000220733
AA Change: S72G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221996
AA Change: S70G

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221999
AA Change: S73G

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222477
AA Change: S38G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000223219
Predicted Effect probably benign
Transcript: ENSMUST00000223528
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,934,657 T22A probably benign Het
A630010A05Rik G T 16: 14,589,227 E7* probably null Het
Abca7 T C 10: 80,009,040 I1532T probably damaging Het
Adam12 T C 7: 133,967,888 D286G probably damaging Het
Ahnak2 T C 12: 112,774,729 T970A probably benign Het
Apcdd1 A G 18: 62,950,056 N319S probably damaging Het
Arih1 A G 9: 59,396,553 M423T probably benign Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Ccdc110 A T 8: 45,943,103 Q677L probably damaging Het
Ccdc171 A G 4: 83,696,300 N1046S probably damaging Het
Ccdc63 G T 5: 122,113,181 Q389K possibly damaging Het
Cd274 T C 19: 29,384,128 S279P probably damaging Het
Cdcp2 A T 4: 107,105,358 I243F probably damaging Het
Cul2 A T 18: 3,426,164 K414* probably null Het
Daglb A G 5: 143,478,463 H243R probably benign Het
Dnah5 A T 15: 28,239,976 Y493F probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eea1 G T 10: 95,994,989 E171* probably null Het
Eml6 C T 11: 29,754,910 G1545R probably damaging Het
Epg5 A G 18: 78,030,150 I2463V probably benign Het
Fgl1 A G 8: 41,191,583 Y295H probably damaging Het
Frrs1 A G 3: 116,881,776 T118A probably damaging Het
Gdi2 T C 13: 3,548,906 V30A probably damaging Het
Gm6583 C A 5: 112,355,697 R47L probably benign Het
Ints4 A G 7: 97,516,525 probably null Het
Iqsec3 A G 6: 121,413,499 S338P unknown Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Ldah A G 12: 8,284,039 E310G probably damaging Het
Mtnr1b A G 9: 15,874,267 V65A probably damaging Het
Myo7b G T 18: 31,965,624 T1735K probably damaging Het
Neb A T 2: 52,325,722 V191D possibly damaging Het
Oas1e T C 5: 120,786,643 T377A unknown Het
Olfr1055 A T 2: 86,347,186 H193Q probably benign Het
Olfr122 T C 17: 37,771,989 F112S possibly damaging Het
Olfr1418 G A 19: 11,855,102 P284S probably damaging Het
Plcl2 T C 17: 50,687,787 S1095P probably damaging Het
Polq A G 16: 37,042,215 K637E possibly damaging Het
Rbm47 T C 5: 66,026,853 I136V probably benign Het
Serpinb3c A C 1: 107,276,304 N59K probably benign Het
Shcbp1 T A 8: 4,767,930 N122Y probably damaging Het
Sim2 T C 16: 94,122,644 V347A probably benign Het
Slc22a30 A T 19: 8,404,540 Y122* probably null Het
Slc34a2 G A 5: 53,068,359 S450N probably benign Het
Snx17 A T 5: 31,197,702 M354L probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Surf6 G A 2: 26,892,368 Q316* probably null Het
Tiprl A G 1: 165,228,422 S44P probably benign Het
Tmem39a C A 16: 38,590,996 L438M probably damaging Het
Tmem39a T G 16: 38,590,997 L438R probably damaging Het
Tns2 G C 15: 102,111,390 V572L probably benign Het
Trdn T C 10: 33,083,628 probably benign Het
Trpc7 T C 13: 56,804,598 I587V probably benign Het
Usp47 A G 7: 112,093,187 D952G probably damaging Het
Vmn2r58 A T 7: 41,861,968 N470K probably damaging Het
Vmn2r67 A T 7: 85,155,889 I5N probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ythdc2 A G 18: 44,877,740 D1272G probably benign Het
Zfp959 A G 17: 55,898,496 Y511C probably benign Het
Other mutations in Platr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6272:Platr25 UTSW 13 62672997 missense possibly damaging 0.82
R6379:Platr25 UTSW 13 62706237 missense probably damaging 1.00
R6548:Platr25 UTSW 13 62673809 missense possibly damaging 0.93
R6728:Platr25 UTSW 13 62700383 missense probably damaging 1.00
R6951:Platr25 UTSW 13 62705748 missense probably benign 0.00
R7365:Platr25 UTSW 13 62700905 missense probably benign
R7885:Platr25 UTSW 13 62700862 missense possibly damaging 0.91
R8331:Platr25 UTSW 13 62700903 missense probably benign 0.01
R8514:Platr25 UTSW 13 62700772 missense probably damaging 1.00
R8754:Platr25 UTSW 13 62700110 makesense probably null
R8822:Platr25 UTSW 13 62700844 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GAAAAGGCTTTACCACACAGATCA -3'
(R):5'- CATGCCATCTCAGGTATCTTTGAA -3'

Sequencing Primer
(F):5'- GAAAAGGCTTTTTCCCACTGGTGAC -3'
(R):5'- GGTATCTTTGAAGCTGAAAAACAACC -3'
Posted On2020-06-30