Incidental Mutation 'R8114:Dnah5'
ID 631083
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms Dnahc5, b2b3491Clo, b2b1154Clo, b2b1134Clo, b2b1565Clo, b2b1537Clo, Mdnah5
MMRRC Submission 067543-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.791) question?
Stock # R8114 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 28203898-28472198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28240122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 493 (Y493F)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: Y493F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: Y493F

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik G T 16: 14,407,091 (GRCm39) E7* probably null Het
Abca7 T C 10: 79,844,874 (GRCm39) I1532T probably damaging Het
Adam12 T C 7: 133,569,617 (GRCm39) D286G probably damaging Het
Ahnak2 T C 12: 112,741,163 (GRCm39) T970A probably benign Het
Apcdd1 A G 18: 63,083,127 (GRCm39) N319S probably damaging Het
Arih1 A G 9: 59,303,836 (GRCm39) M423T probably benign Het
Ccdc110 A T 8: 46,396,140 (GRCm39) Q677L probably damaging Het
Ccdc121rt3 C A 5: 112,503,563 (GRCm39) R47L probably benign Het
Ccdc171 A G 4: 83,614,537 (GRCm39) N1046S probably damaging Het
Ccdc63 G T 5: 122,251,244 (GRCm39) Q389K possibly damaging Het
Cd274 T C 19: 29,361,528 (GRCm39) S279P probably damaging Het
Cdcp2 A T 4: 106,962,555 (GRCm39) I243F probably damaging Het
Cfap298 T C 16: 90,731,545 (GRCm39) T22A probably benign Het
Cul2 A T 18: 3,426,164 (GRCm39) K414* probably null Het
Daglb A G 5: 143,464,218 (GRCm39) H243R probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Eea1 G T 10: 95,830,851 (GRCm39) E171* probably null Het
Eml6 C T 11: 29,704,910 (GRCm39) G1545R probably damaging Het
Epg5 A G 18: 78,073,365 (GRCm39) I2463V probably benign Het
Fgl1 A G 8: 41,644,620 (GRCm39) Y295H probably damaging Het
Frrs1 A G 3: 116,675,425 (GRCm39) T118A probably damaging Het
Gdi2 T C 13: 3,598,906 (GRCm39) V30A probably damaging Het
Ints4 A G 7: 97,165,732 (GRCm39) probably null Het
Iqsec3 A G 6: 121,390,458 (GRCm39) S338P unknown Het
Klhl3 C T 13: 58,161,677 (GRCm39) V473M possibly damaging Het
Ldah A G 12: 8,334,039 (GRCm39) E310G probably damaging Het
Mtnr1b A G 9: 15,785,563 (GRCm39) V65A probably damaging Het
Myo7b G T 18: 32,098,677 (GRCm39) T1735K probably damaging Het
Neb A T 2: 52,215,734 (GRCm39) V191D possibly damaging Het
Oas1e T C 5: 120,924,708 (GRCm39) T377A unknown Het
Odr4 A T 1: 150,264,308 (GRCm39) L67* probably null Het
Or10al6 T C 17: 38,082,880 (GRCm39) F112S possibly damaging Het
Or10v9 G A 19: 11,832,466 (GRCm39) P284S probably damaging Het
Or8k53 A T 2: 86,177,530 (GRCm39) H193Q probably benign Het
Platr25 T C 13: 62,821,738 (GRCm39) S70G possibly damaging Het
Plcl2 T C 17: 50,994,815 (GRCm39) S1095P probably damaging Het
Polq A G 16: 36,862,577 (GRCm39) K637E possibly damaging Het
Rbm47 T C 5: 66,184,196 (GRCm39) I136V probably benign Het
Serpinb3c A C 1: 107,204,034 (GRCm39) N59K probably benign Het
Shcbp1 T A 8: 4,817,930 (GRCm39) N122Y probably damaging Het
Sim2 T C 16: 93,923,503 (GRCm39) V347A probably benign Het
Slc22a30 A T 19: 8,381,904 (GRCm39) Y122* probably null Het
Slc34a2 G A 5: 53,225,701 (GRCm39) S450N probably benign Het
Snx17 A T 5: 31,355,046 (GRCm39) M354L probably benign Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Surf6 G A 2: 26,782,380 (GRCm39) Q316* probably null Het
Tiprl A G 1: 165,055,991 (GRCm39) S44P probably benign Het
Tmem39a T G 16: 38,411,359 (GRCm39) L438R probably damaging Het
Tmem39a C A 16: 38,411,358 (GRCm39) L438M probably damaging Het
Tns2 G C 15: 102,019,825 (GRCm39) V572L probably benign Het
Trdn T C 10: 32,959,624 (GRCm39) probably benign Het
Trpc7 T C 13: 56,952,411 (GRCm39) I587V probably benign Het
Usp47 A G 7: 111,692,394 (GRCm39) D952G probably damaging Het
Vmn2r58 A T 7: 41,511,392 (GRCm39) N470K probably damaging Het
Vmn2r67 A T 7: 84,805,097 (GRCm39) I5N probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Ythdc2 A G 18: 45,010,807 (GRCm39) D1272G probably benign Het
Zfp959 A G 17: 56,205,496 (GRCm39) Y511C probably benign Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,488 (GRCm39) missense probably benign
IGL00331:Dnah5 APN 15 28,421,766 (GRCm39) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,364 (GRCm39) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,848 (GRCm39) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,149 (GRCm39) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,545 (GRCm39) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,802 (GRCm39) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,295,059 (GRCm39) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,418 (GRCm39) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,636 (GRCm39) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,686 (GRCm39) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,815 (GRCm39) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,872 (GRCm39) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,798 (GRCm39) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,783 (GRCm39) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,480 (GRCm39) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,928 (GRCm39) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,315 (GRCm39) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,510 (GRCm39) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,899 (GRCm39) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,435 (GRCm39) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,682 (GRCm39) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,698 (GRCm39) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,264 (GRCm39) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,187 (GRCm39) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,270 (GRCm39) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,248,031 (GRCm39) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,386 (GRCm39) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,527 (GRCm39) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,296 (GRCm39) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,422 (GRCm39) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,193 (GRCm39) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,768 (GRCm39) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,333 (GRCm39) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,442 (GRCm39) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,289 (GRCm39) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,389 (GRCm39) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,358 (GRCm39) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,771 (GRCm39) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,572 (GRCm39) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,331 (GRCm39) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,607 (GRCm39) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,471 (GRCm39) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,545 (GRCm39) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,309 (GRCm39) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,300 (GRCm39) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,294 (GRCm39) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,795 (GRCm39) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,441 (GRCm39) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,420,086 (GRCm39) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,287 (GRCm39) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,473 (GRCm39) missense possibly damaging 0.95
Firtel UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
lowbar UTSW 15 28,311,279 (GRCm39) splice site probably null
notherone UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
scheffler UTSW 15 28,438,237 (GRCm39) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,546 (GRCm39) missense probably benign
P0008:Dnah5 UTSW 15 28,302,533 (GRCm39) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,619 (GRCm39) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,723 (GRCm39) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,663 (GRCm39) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,759 (GRCm39) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,240,080 (GRCm39) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,897 (GRCm39) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,499 (GRCm39) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,825 (GRCm39) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,509 (GRCm39) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,465 (GRCm39) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,295,071 (GRCm39) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,216 (GRCm39) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,256 (GRCm39) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,727 (GRCm39) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,687 (GRCm39) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,745 (GRCm39) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,467 (GRCm39) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,925 (GRCm39) missense probably benign
R0720:Dnah5 UTSW 15 28,314,007 (GRCm39) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,289 (GRCm39) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,333 (GRCm39) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,332 (GRCm39) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,633 (GRCm39) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,745 (GRCm39) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,617 (GRCm39) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,598 (GRCm39) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,836 (GRCm39) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,403 (GRCm39) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,877 (GRCm39) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,314,064 (GRCm39) splice site probably benign
R1401:Dnah5 UTSW 15 28,402,059 (GRCm39) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,555 (GRCm39) missense probably benign
R1430:Dnah5 UTSW 15 28,346,003 (GRCm39) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,688 (GRCm39) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,609 (GRCm39) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,149 (GRCm39) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,569 (GRCm39) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,326 (GRCm39) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,295,131 (GRCm39) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,294 (GRCm39) missense probably benign
R1755:Dnah5 UTSW 15 28,326,782 (GRCm39) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,932 (GRCm39) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,572 (GRCm39) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,546 (GRCm39) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,270 (GRCm39) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,815 (GRCm39) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,859 (GRCm39) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,737 (GRCm39) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,416 (GRCm39) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,534 (GRCm39) splice site probably null
R2121:Dnah5 UTSW 15 28,297,151 (GRCm39) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,467 (GRCm39) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,237 (GRCm39) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,691 (GRCm39) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,817 (GRCm39) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,563 (GRCm39) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,448 (GRCm39) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,913 (GRCm39) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,314,028 (GRCm39) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,537 (GRCm39) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,722 (GRCm39) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,237 (GRCm39) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,413 (GRCm39) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,937 (GRCm39) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,268 (GRCm39) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,656 (GRCm39) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,421,144 (GRCm39) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,444 (GRCm39) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,937 (GRCm39) missense probably benign
R4245:Dnah5 UTSW 15 28,219,335 (GRCm39) missense probably benign
R4254:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,248 (GRCm39) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,375 (GRCm39) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,300 (GRCm39) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,909 (GRCm39) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,396 (GRCm39) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,745 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,420,140 (GRCm39) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,402,099 (GRCm39) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,406 (GRCm39) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,521 (GRCm39) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,421,101 (GRCm39) splice site probably null
R4767:Dnah5 UTSW 15 28,270,620 (GRCm39) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,953 (GRCm39) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,784 (GRCm39) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,938 (GRCm39) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,388,050 (GRCm39) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,703 (GRCm39) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,518 (GRCm39) missense probably benign
R5033:Dnah5 UTSW 15 28,421,824 (GRCm39) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,438 (GRCm39) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,550 (GRCm39) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,424 (GRCm39) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,318 (GRCm39) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,811 (GRCm39) missense probably benign
R5308:Dnah5 UTSW 15 28,229,797 (GRCm39) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,474 (GRCm39) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,390 (GRCm39) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,872 (GRCm39) missense probably benign
R5596:Dnah5 UTSW 15 28,343,754 (GRCm39) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,420,078 (GRCm39) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,581 (GRCm39) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,210 (GRCm39) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,513 (GRCm39) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,298 (GRCm39) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,967 (GRCm39) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,738 (GRCm39) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,341 (GRCm39) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,159 (GRCm39) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,599 (GRCm39) splice site probably null
R5896:Dnah5 UTSW 15 28,272,206 (GRCm39) missense probably benign
R5899:Dnah5 UTSW 15 28,448,513 (GRCm39) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,473 (GRCm39) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,864 (GRCm39) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,354 (GRCm39) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,353 (GRCm39) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,425 (GRCm39) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,730 (GRCm39) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,428 (GRCm39) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,372 (GRCm39) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,328,030 (GRCm39) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,979 (GRCm39) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,614 (GRCm39) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,566 (GRCm39) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,377 (GRCm39) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,331 (GRCm39) missense probably benign
R6154:Dnah5 UTSW 15 28,204,177 (GRCm39) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,489 (GRCm39) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,773 (GRCm39) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,557 (GRCm39) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,657 (GRCm39) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,970 (GRCm39) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,329 (GRCm39) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,891 (GRCm39) missense probably benign
R6607:Dnah5 UTSW 15 28,445,346 (GRCm39) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,266 (GRCm39) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,933 (GRCm39) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,633 (GRCm39) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,302 (GRCm39) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,384 (GRCm39) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,609 (GRCm39) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,661 (GRCm39) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,770 (GRCm39) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,786 (GRCm39) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,866 (GRCm39) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,208 (GRCm39) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,738 (GRCm39) missense probably benign
R7032:Dnah5 UTSW 15 28,326,796 (GRCm39) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,394 (GRCm39) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,482 (GRCm39) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,410 (GRCm39) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,983 (GRCm39) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,668 (GRCm39) splice site probably null
R7209:Dnah5 UTSW 15 28,459,371 (GRCm39) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,984 (GRCm39) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,616 (GRCm39) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,965 (GRCm39) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,524 (GRCm39) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,596 (GRCm39) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,561 (GRCm39) missense probably benign
R7519:Dnah5 UTSW 15 28,390,629 (GRCm39) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,212 (GRCm39) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,389 (GRCm39) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,347,098 (GRCm39) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,402,014 (GRCm39) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,248,125 (GRCm39) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,378 (GRCm39) splice site probably null
R7763:Dnah5 UTSW 15 28,314,001 (GRCm39) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,678 (GRCm39) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,958 (GRCm39) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,830 (GRCm39) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,560 (GRCm39) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,742 (GRCm39) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,368 (GRCm39) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,983 (GRCm39) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,323 (GRCm39) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,729 (GRCm39) missense probably benign
R8084:Dnah5 UTSW 15 28,388,099 (GRCm39) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,548 (GRCm39) missense probably benign
R8142:Dnah5 UTSW 15 28,384,519 (GRCm39) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,576 (GRCm39) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,850 (GRCm39) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,279 (GRCm39) splice site probably null
R8187:Dnah5 UTSW 15 28,384,355 (GRCm39) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,414 (GRCm39) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,538 (GRCm39) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,743 (GRCm39) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,347,011 (GRCm39) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,812 (GRCm39) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,313 (GRCm39) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,469 (GRCm39) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,956 (GRCm39) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,489 (GRCm39) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,978 (GRCm39) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,941 (GRCm39) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,977 (GRCm39) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,414 (GRCm39) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,245 (GRCm39) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,367 (GRCm39) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,346,006 (GRCm39) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,365 (GRCm39) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,388,097 (GRCm39) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,719 (GRCm39) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,502 (GRCm39) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,334 (GRCm39) missense probably benign
R8885:Dnah5 UTSW 15 28,327,886 (GRCm39) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,715 (GRCm39) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,412 (GRCm39) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,248,104 (GRCm39) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,391,014 (GRCm39) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,812 (GRCm39) missense probably benign
R9065:Dnah5 UTSW 15 28,293,936 (GRCm39) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,420,107 (GRCm39) missense
R9118:Dnah5 UTSW 15 28,401,994 (GRCm39) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,914 (GRCm39) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,552 (GRCm39) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,480 (GRCm39) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9302:Dnah5 UTSW 15 28,240,032 (GRCm39) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,579 (GRCm39) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,204,054 (GRCm39) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,306 (GRCm39) missense probably benign
R9424:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,293 (GRCm39) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,146 (GRCm39) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,328,025 (GRCm39) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,422 (GRCm39) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,286 (GRCm39) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,774 (GRCm39) missense probably benign
R9644:Dnah5 UTSW 15 28,230,650 (GRCm39) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,900 (GRCm39) missense probably benign
R9657:Dnah5 UTSW 15 28,410,089 (GRCm39) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,965 (GRCm39) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,316 (GRCm39) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,165 (GRCm39) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,527 (GRCm39) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,500 (GRCm39) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,557 (GRCm39) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,454 (GRCm39) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,623 (GRCm39) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,503 (GRCm39) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,376 (GRCm39) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,457 (GRCm39) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,549 (GRCm39) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,500 (GRCm39) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,909 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCATGTTAGGGGTTGAGCTC -3'
(R):5'- TCCTTGTAACCACACACCTG -3'

Sequencing Primer
(F):5'- AGCTCAGGATTTGTTCTCTACCTAAG -3'
(R):5'- ATGGACTAGTACCGTTATGCAG -3'
Posted On 2020-06-30