Incidental Mutation 'R8114:1110004E09Rik'
ID 631089
Institutional Source Beutler Lab
Gene Symbol 1110004E09Rik
Ensembl Gene ENSMUSG00000022972
Gene Name RIKEN cDNA 1110004E09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8114 (G1)
Quality Score 168.009
Status Validated
Chromosome 16
Chromosomal Location 90925809-90935114 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90934657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000023694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023694] [ENSMUST00000121759] [ENSMUST00000125519] [ENSMUST00000129743] [ENSMUST00000142340] [ENSMUST00000149833] [ENSMUST00000170853]
AlphaFold Q8BL95
Predicted Effect probably benign
Transcript: ENSMUST00000023694
AA Change: T22A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023694
Gene: ENSMUSG00000022972
AA Change: T22A

DomainStartEndE-ValueType
Pfam:DUF2870 189 285 4.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118390
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121759
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125519
AA Change: T22A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000129345
SMART Domains Protein: ENSMUSP00000122163
Gene: ENSMUSG00000022972

DomainStartEndE-ValueType
Pfam:DUF2870 87 122 6.2e-17 PFAM
Pfam:DUF2870 118 151 4.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129743
SMART Domains Protein: ENSMUSP00000123231
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142340
Predicted Effect probably benign
Transcript: ENSMUST00000149833
AA Change: T22A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123417
Gene: ENSMUSG00000022972
AA Change: T22A

DomainStartEndE-ValueType
Pfam:DUF2870 171 198 5.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154276
SMART Domains Protein: ENSMUSP00000122675
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 154 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170853
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene a protein plays a critical role in dynein arm assembly and motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik G T 16: 14,589,227 E7* probably null Het
Abca7 T C 10: 80,009,040 I1532T probably damaging Het
Adam12 T C 7: 133,967,888 D286G probably damaging Het
Ahnak2 T C 12: 112,774,729 T970A probably benign Het
Apcdd1 A G 18: 62,950,056 N319S probably damaging Het
Arih1 A G 9: 59,396,553 M423T probably benign Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Ccdc110 A T 8: 45,943,103 Q677L probably damaging Het
Ccdc171 A G 4: 83,696,300 N1046S probably damaging Het
Ccdc63 G T 5: 122,113,181 Q389K possibly damaging Het
Cd274 T C 19: 29,384,128 S279P probably damaging Het
Cdcp2 A T 4: 107,105,358 I243F probably damaging Het
Cul2 A T 18: 3,426,164 K414* probably null Het
Daglb A G 5: 143,478,463 H243R probably benign Het
Dnah5 A T 15: 28,239,976 Y493F probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eea1 G T 10: 95,994,989 E171* probably null Het
Eml6 C T 11: 29,754,910 G1545R probably damaging Het
Epg5 A G 18: 78,030,150 I2463V probably benign Het
Fgl1 A G 8: 41,191,583 Y295H probably damaging Het
Frrs1 A G 3: 116,881,776 T118A probably damaging Het
Gdi2 T C 13: 3,548,906 V30A probably damaging Het
Gm6583 C A 5: 112,355,697 R47L probably benign Het
Ints4 A G 7: 97,516,525 probably null Het
Iqsec3 A G 6: 121,413,499 S338P unknown Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Ldah A G 12: 8,284,039 E310G probably damaging Het
Mtnr1b A G 9: 15,874,267 V65A probably damaging Het
Myo7b G T 18: 31,965,624 T1735K probably damaging Het
Neb A T 2: 52,325,722 V191D possibly damaging Het
Oas1e T C 5: 120,786,643 T377A unknown Het
Olfr1055 A T 2: 86,347,186 H193Q probably benign Het
Olfr122 T C 17: 37,771,989 F112S possibly damaging Het
Olfr1418 G A 19: 11,855,102 P284S probably damaging Het
Platr25 T C 13: 62,673,924 S70G possibly damaging Het
Plcl2 T C 17: 50,687,787 S1095P probably damaging Het
Polq A G 16: 37,042,215 K637E possibly damaging Het
Rbm47 T C 5: 66,026,853 I136V probably benign Het
Serpinb3c A C 1: 107,276,304 N59K probably benign Het
Shcbp1 T A 8: 4,767,930 N122Y probably damaging Het
Sim2 T C 16: 94,122,644 V347A probably benign Het
Slc22a30 A T 19: 8,404,540 Y122* probably null Het
Slc34a2 G A 5: 53,068,359 S450N probably benign Het
Snx17 A T 5: 31,197,702 M354L probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Surf6 G A 2: 26,892,368 Q316* probably null Het
Tiprl A G 1: 165,228,422 S44P probably benign Het
Tmem39a C A 16: 38,590,996 L438M probably damaging Het
Tmem39a T G 16: 38,590,997 L438R probably damaging Het
Tns2 G C 15: 102,111,390 V572L probably benign Het
Trdn T C 10: 33,083,628 probably benign Het
Trpc7 T C 13: 56,804,598 I587V probably benign Het
Usp47 A G 7: 112,093,187 D952G probably damaging Het
Vmn2r58 A T 7: 41,861,968 N470K probably damaging Het
Vmn2r67 A T 7: 85,155,889 I5N probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Ythdc2 A G 18: 44,877,740 D1272G probably benign Het
Zfp959 A G 17: 55,898,496 Y511C probably benign Het
Other mutations in 1110004E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:1110004E09Rik APN 16 90926048 missense possibly damaging 0.60
IGL02607:1110004E09Rik APN 16 90929947 missense probably damaging 1.00
IGL02826:1110004E09Rik APN 16 90926062 missense probably benign 0.02
R0920:1110004E09Rik UTSW 16 90927379 missense probably damaging 0.98
R4586:1110004E09Rik UTSW 16 90927426 missense probably damaging 1.00
R5415:1110004E09Rik UTSW 16 90926065 missense probably benign 0.05
R5443:1110004E09Rik UTSW 16 90927211 missense probably benign
R8191:1110004E09Rik UTSW 16 90931001 missense probably damaging 0.99
R8699:1110004E09Rik UTSW 16 90931057 missense probably benign 0.03
R8876:1110004E09Rik UTSW 16 90927393 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CTTAGCTCAGCCTCACTTGG -3'
(R):5'- AGCAGCGGTTAATCTCAGGC -3'

Sequencing Primer
(F):5'- ATCCCCGGTCAACCCTGATG -3'
(R):5'- AGCGGTTAATCTCAGGCTGGTG -3'
Posted On 2020-06-30