Mutagenetix > Incidental Mutations

Incidental Mutation 'R8114:Apcdd1'

631098

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R8114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62950056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 319 (N319S)

Ref Sequence

ENSEMBL: ENSMUSP00000094302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably damaging
Transcript: ENSMUST00000096554
AA Change: N319S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: N319S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163716
AA Change: N319S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: N319S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.5%
20x: 94.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	T	C	16: 90,934,657	T22A	probably benign	Het
A630010A05Rik	G	T	16: 14,589,227	E7*	probably null	Het
Abca7	T	C	10: 80,009,040	I1532T	probably damaging	Het
Adam12	T	C	7: 133,967,888	D286G	probably damaging	Het
Ahnak2	T	C	12: 112,774,729	T970A	probably benign	Het
Arih1	A	G	9: 59,396,553	M423T	probably benign	Het
BC003331	A	T	1: 150,388,557	L67*	probably null	Het
Ccdc110	A	T	8: 45,943,103	Q677L	probably damaging	Het
Ccdc171	A	G	4: 83,696,300	N1046S	probably damaging	Het
Ccdc63	G	T	5: 122,113,181	Q389K	possibly damaging	Het
Cd274	T	C	19: 29,384,128	S279P	probably damaging	Het
Cdcp2	A	T	4: 107,105,358	I243F	probably damaging	Het
Cul2	A	T	18: 3,426,164	K414*	probably null	Het
Daglb	A	G	5: 143,478,463	H243R	probably benign	Het
Dnah5	A	T	15: 28,239,976	Y493F	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Eea1	G	T	10: 95,994,989	E171*	probably null	Het
Eml6	C	T	11: 29,754,910	G1545R	probably damaging	Het
Epg5	A	G	18: 78,030,150	I2463V	probably benign	Het
Fgl1	A	G	8: 41,191,583	Y295H	probably damaging	Het
Frrs1	A	G	3: 116,881,776	T118A	probably damaging	Het
Gdi2	T	C	13: 3,548,906	V30A	probably damaging	Het
Gm6583	C	A	5: 112,355,697	R47L	probably benign	Het
Ints4	A	G	7: 97,516,525		probably null	Het
Iqsec3	A	G	6: 121,413,499	S338P	unknown	Het
Klhl3	C	T	13: 58,013,863	V473M	possibly damaging	Het
Ldah	A	G	12: 8,284,039	E310G	probably damaging	Het
Mtnr1b	A	G	9: 15,874,267	V65A	probably damaging	Het
Myo7b	G	T	18: 31,965,624	T1735K	probably damaging	Het
Neb	A	T	2: 52,325,722	V191D	possibly damaging	Het
Oas1e	T	C	5: 120,786,643	T377A	unknown	Het
Olfr1055	A	T	2: 86,347,186	H193Q	probably benign	Het
Olfr122	T	C	17: 37,771,989	F112S	possibly damaging	Het
Olfr1418	G	A	19: 11,855,102	P284S	probably damaging	Het
Platr25	T	C	13: 62,673,924	S70G	possibly damaging	Het
Plcl2	T	C	17: 50,687,787	S1095P	probably damaging	Het
Polq	A	G	16: 37,042,215	K637E	possibly damaging	Het
Rbm47	T	C	5: 66,026,853	I136V	probably benign	Het
Serpinb3c	A	C	1: 107,276,304	N59K	probably benign	Het
Shcbp1	T	A	8: 4,767,930	N122Y	probably damaging	Het
Sim2	T	C	16: 94,122,644	V347A	probably benign	Het
Slc22a30	A	T	19: 8,404,540	Y122*	probably null	Het
Slc34a2	G	A	5: 53,068,359	S450N	probably benign	Het
Snx17	A	T	5: 31,197,702	M354L	probably benign	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Surf6	G	A	2: 26,892,368	Q316*	probably null	Het
Tiprl	A	G	1: 165,228,422	S44P	probably benign	Het
Tmem39a	C	A	16: 38,590,996	L438M	probably damaging	Het
Tmem39a	T	G	16: 38,590,997	L438R	probably damaging	Het
Tns2	G	C	15: 102,111,390	V572L	probably benign	Het
Trdn	T	C	10: 33,083,628		probably benign	Het
Trpc7	T	C	13: 56,804,598	I587V	probably benign	Het
Usp47	A	G	7: 112,093,187	D952G	probably damaging	Het
Vmn2r58	A	T	7: 41,861,968	N470K	probably damaging	Het
Vmn2r67	A	T	7: 85,155,889	I5N	probably benign	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Ythdc2	A	G	18: 44,877,740	D1272G	probably benign	Het
Zfp959	A	G	17: 55,898,496	Y511C	probably benign	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAACCATGCGTGCATAGCC -3'
(R):5'- AGCAGCAAAGATACCCTTTCTC -3'

Sequencing Primer
(F):5'- GCATAGCCTGCCGCATC -3'
(R):5'- TCTGTCCCAGCAGAAATGTG -3'

Posted On

2020-06-30