Incidental Mutation 'R8115:Kcnb2'
ID 631103
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms Kv2.2, 9630047L19Rik
MMRRC Submission 067544-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8115 (G1)
Quality Score 190.009
Status Validated
Chromosome 1
Chromosomal Location 15357478-15793974 bp(+) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 15781851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Arginine at position 908 (*908R)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably null
Transcript: ENSMUST00000170146
AA Change: *908R
Predicted Effect probably null
Transcript: ENSMUST00000175681
AA Change: *908R
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: *908R

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,996 (GRCm39) I211L probably benign Het
Abhd16b G A 2: 181,135,527 (GRCm39) R143H possibly damaging Het
Abt1 T C 13: 23,606,402 (GRCm39) E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,322,498 (GRCm39) probably null Het
Asxl3 G A 18: 22,650,642 (GRCm39) R877Q probably damaging Het
B3galt1 A G 2: 67,948,320 (GRCm39) T12A possibly damaging Het
Bcat1 G A 6: 144,955,819 (GRCm39) P354L probably damaging Het
C9orf72 T C 4: 35,218,763 (GRCm39) Y32C Het
Cad T C 5: 31,218,271 (GRCm39) F452L possibly damaging Het
Cadps2 T A 6: 23,328,897 (GRCm39) I973F probably benign Het
Cenpq T C 17: 41,243,720 (GRCm39) N43D probably damaging Het
Chd9 G T 8: 91,762,960 (GRCm39) V2262L probably damaging Het
Cttnbp2nl G T 3: 104,913,402 (GRCm39) Q161K probably damaging Het
D630003M21Rik A T 2: 158,058,510 (GRCm39) H463Q probably benign Het
Defb1 C T 8: 22,284,500 (GRCm39) H40Y probably benign Het
Dmrtb1 A T 4: 107,534,256 (GRCm39) D186E probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efr3a T A 15: 65,738,644 (GRCm39) F758I probably damaging Het
Fap A G 2: 62,349,385 (GRCm39) I501T probably benign Het
Galr3 C T 15: 78,927,524 (GRCm39) R322* probably null Het
Hrnr C A 3: 93,231,039 (GRCm39) R426S unknown Het
Hsp90ab1 A T 17: 45,880,201 (GRCm39) M476K possibly damaging Het
Igsf3 G T 3: 101,362,595 (GRCm39) R872L probably benign Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Iqsec3 T G 6: 121,449,989 (GRCm39) R178S unknown Het
Itgbl1 T C 14: 124,094,955 (GRCm39) C327R probably damaging Het
Itsn2 A T 12: 4,723,602 (GRCm39) Q1179L possibly damaging Het
Kdm5b G T 1: 134,547,411 (GRCm39) W1020L possibly damaging Het
Kpna3 C A 14: 61,608,367 (GRCm39) V364L probably damaging Het
Lsm14a T C 7: 34,074,662 (GRCm39) I93V probably benign Het
Mast2 A G 4: 116,292,644 (GRCm39) S109P probably benign Het
Muc4 G A 16: 32,575,678 (GRCm39) S1726N unknown Het
Myo7a T C 7: 97,715,653 (GRCm39) D1477G probably damaging Het
Nostrin G A 2: 69,011,264 (GRCm39) probably null Het
Oasl1 T A 5: 115,074,996 (GRCm39) V352E probably damaging Het
Or9a2 T A 6: 41,748,472 (GRCm39) T254S probably benign Het
Pafah1b1 A G 11: 74,575,319 (GRCm39) V195A probably damaging Het
Pcdhb4 G A 18: 37,442,453 (GRCm39) V588M probably damaging Het
Pcsk5 A G 19: 17,487,530 (GRCm39) probably null Het
Peg10 A G 6: 4,756,707 (GRCm39) I428V unknown Het
Pmfbp1 G A 8: 110,263,669 (GRCm39) V824M probably damaging Het
Prkag3 T C 1: 74,787,118 (GRCm39) R47G possibly damaging Het
Prl8a1 T A 13: 27,758,028 (GRCm39) H227L probably benign Het
Prune2 A G 19: 17,101,288 (GRCm39) D2264G probably benign Het
Psg28 A G 7: 18,164,311 (GRCm39) Y134H probably benign Het
Rab3gap2 T A 1: 184,999,447 (GRCm39) Y1019N possibly damaging Het
Rbm15 A T 3: 107,238,966 (GRCm39) F477L probably damaging Het
Ric1 A T 19: 29,563,973 (GRCm39) N576Y probably damaging Het
S1pr1 T A 3: 115,506,298 (GRCm39) T99S probably benign Het
Serpinb9b G T 13: 33,219,531 (GRCm39) V153F probably null Het
Sh2d3c A G 2: 32,615,276 (GRCm39) E122G probably benign Het
Slc6a11 T A 6: 114,108,442 (GRCm39) W69R probably damaging Het
Slco6c1 T A 1: 97,000,686 (GRCm39) I539F probably damaging Het
Smgc G T 15: 91,733,322 (GRCm39) probably null Het
Spata17 T C 1: 186,849,653 (GRCm39) Y194C probably damaging Het
Tap1 A T 17: 34,412,293 (GRCm39) probably null Het
Topbp1 T C 9: 103,197,740 (GRCm39) S440P probably benign Het
Trpc6 T C 9: 8,609,982 (GRCm39) L150P probably damaging Het
Ttll4 C T 1: 74,726,489 (GRCm39) Q696* probably null Het
Ubash3b C T 9: 40,937,624 (GRCm39) E447K probably damaging Het
Unc5cl T C 17: 48,774,438 (GRCm39) S477P possibly damaging Het
Unc80 A G 1: 66,688,072 (GRCm39) T2357A probably benign Het
Vmn1r58 A T 7: 5,413,341 (GRCm39) S296R probably benign Het
Vmn2r85 G T 10: 130,261,820 (GRCm39) N172K probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Yipf7 T A 5: 69,684,570 (GRCm39) T82S probably benign Het
Zap70 A G 1: 36,820,287 (GRCm39) S523G probably damaging Het
Zfp354a A G 11: 50,960,490 (GRCm39) T233A probably benign Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15,781,236 (GRCm39) missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15,383,147 (GRCm39) missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15,781,048 (GRCm39) missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15,383,178 (GRCm39) missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15,781,033 (GRCm39) missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15,780,085 (GRCm39) missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15,781,159 (GRCm39) missense probably benign
IGL02526:Kcnb2 APN 1 15,780,979 (GRCm39) missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15,780,730 (GRCm39) missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15,781,435 (GRCm39) missense probably benign
IGL03144:Kcnb2 APN 1 15,780,112 (GRCm39) missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15,383,200 (GRCm39) missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15,783,137 (GRCm39) unclassified probably benign
R0538:Kcnb2 UTSW 1 15,783,108 (GRCm39) unclassified probably benign
R0611:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15,781,012 (GRCm39) missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15,779,979 (GRCm39) missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15,779,990 (GRCm39) missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15,781,540 (GRCm39) missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15,779,791 (GRCm39) missense probably benign
R3025:Kcnb2 UTSW 1 15,781,059 (GRCm39) missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15,780,639 (GRCm39) missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15,383,186 (GRCm39) missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15,779,724 (GRCm39) missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15,781,068 (GRCm39) missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15,781,716 (GRCm39) missense probably benign
R5926:Kcnb2 UTSW 1 15,383,235 (GRCm39) missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15,780,790 (GRCm39) missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15,781,436 (GRCm39) missense probably benign
R6724:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15,780,480 (GRCm39) missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15,383,150 (GRCm39) missense probably benign
R7352:Kcnb2 UTSW 1 15,780,835 (GRCm39) missense probably benign
R7419:Kcnb2 UTSW 1 15,781,251 (GRCm39) missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15,780,031 (GRCm39) missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15,383,064 (GRCm39) missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15,780,837 (GRCm39) missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15,383,004 (GRCm39) missense probably damaging 0.98
R8156:Kcnb2 UTSW 1 15,780,280 (GRCm39) missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15,781,777 (GRCm39) missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15,382,934 (GRCm39) missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15,780,876 (GRCm39) missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15,780,648 (GRCm39) missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15,781,723 (GRCm39) missense probably benign
R9321:Kcnb2 UTSW 1 15,779,793 (GRCm39) missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15,779,737 (GRCm39) missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15,781,444 (GRCm39) missense probably benign
R9709:Kcnb2 UTSW 1 15,780,523 (GRCm39) missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15,781,252 (GRCm39) missense probably benign 0.01
Z1088:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.03
Z1177:Kcnb2 UTSW 1 15,781,182 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCGATGCCAGAGACTCTTTAAG -3'
(R):5'- TTGCTCGCTATTCAGGACTC -3'

Sequencing Primer
(F):5'- TCTTTAAGAGAAGAGGGCTGTG -3'
(R):5'- TCAGGACTCGGTTTTATTTAAACAG -3'
Posted On 2020-06-30