Incidental Mutation 'R8115:Rbm15'
ID631121
Institutional Source Beutler Lab
Gene Symbol Rbm15
Ensembl Gene ENSMUSG00000048109
Gene NameRNA binding motif protein 15
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8115 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107325421-107333673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107331650 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 477 (F477L)
Ref Sequence ENSEMBL: ENSMUSP00000054424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061772]
Predicted Effect probably damaging
Transcript: ENSMUST00000061772
AA Change: F477L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054424
Gene: ENSMUSG00000048109
AA Change: F477L

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 56 96 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 133 163 N/A INTRINSIC
RRM 170 247 7.49e-5 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
RRM 374 446 1.33e-10 SMART
RRM 455 524 2.51e-6 SMART
low complexity region 532 542 N/A INTRINSIC
low complexity region 564 582 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
internal_repeat_2 613 685 7.13e-5 PROSPERO
internal_repeat_2 677 753 7.13e-5 PROSPERO
low complexity region 754 771 N/A INTRINSIC
Pfam:SPOC 789 925 1.7e-33 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality around E9.5. Mice homozygous for a floxed allele activate in hematopoietic cells exhibit increased megakaryocyte cell number, long-term hematopoietic stem cells, and red pulp as well as decreased B cells and leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T C 4: 35,218,763 Y32C Het
A1bg T G 15: 60,920,147 I211L probably benign Het
Abhd16b G A 2: 181,493,734 R143H possibly damaging Het
Abt1 T C 13: 23,422,232 E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,345,513 probably null Het
Asxl3 G A 18: 22,517,585 R877Q probably damaging Het
B3galt1 A G 2: 68,117,976 T12A possibly damaging Het
Bcat1 G A 6: 145,010,093 P354L probably damaging Het
Cad T C 5: 31,060,927 F452L possibly damaging Het
Cadps2 T A 6: 23,328,898 I973F probably benign Het
Cenpq T C 17: 40,932,829 N43D probably damaging Het
Chd9 G T 8: 91,036,332 V2262L probably damaging Het
Cttnbp2nl G T 3: 105,006,086 Q161K probably damaging Het
D630003M21Rik A T 2: 158,216,590 H463Q probably benign Het
Defb1 C T 8: 21,794,484 H40Y probably benign Het
Dmrtb1 A T 4: 107,677,059 D186E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efr3a T A 15: 65,866,795 F758I probably damaging Het
Fap A G 2: 62,519,041 I501T probably benign Het
Galr3 C T 15: 79,043,324 R322* probably null Het
Hrnr C A 3: 93,323,732 R426S unknown Het
Hsp90ab1 A T 17: 45,569,275 M476K possibly damaging Het
Igsf3 G T 3: 101,455,279 R872L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqsec3 T G 6: 121,473,030 R178S unknown Het
Itgbl1 T C 14: 123,857,543 C327R probably damaging Het
Itsn2 A T 12: 4,673,602 Q1179L possibly damaging Het
Kcnb2 T C 1: 15,711,627 *908R probably null Het
Kdm5b G T 1: 134,619,673 W1020L possibly damaging Het
Kpna3 C A 14: 61,370,918 V364L probably damaging Het
Lsm14a T C 7: 34,375,237 I93V probably benign Het
Mast2 A G 4: 116,435,447 S109P probably benign Het
Muc4 G A 16: 32,755,304 S1726N unknown Het
Myo7a T C 7: 98,066,446 D1477G probably damaging Het
Nostrin G A 2: 69,180,920 probably null Het
Oasl1 T A 5: 114,936,937 V352E probably damaging Het
Olfr459 T A 6: 41,771,538 T254S probably benign Het
Pafah1b1 A G 11: 74,684,493 V195A probably damaging Het
Pcdhb4 G A 18: 37,309,400 V588M probably damaging Het
Pcsk5 A G 19: 17,510,166 probably null Het
Peg10 A G 6: 4,756,707 I428V unknown Het
Pmfbp1 G A 8: 109,537,037 V824M probably damaging Het
Prkag3 T C 1: 74,747,959 R47G possibly damaging Het
Prl8a1 T A 13: 27,574,045 H227L probably benign Het
Prune2 A G 19: 17,123,924 D2264G probably benign Het
Psg28 A G 7: 18,430,386 Y134H probably benign Het
Rab3gap2 T A 1: 185,267,250 Y1019N possibly damaging Het
Ric1 A T 19: 29,586,573 N576Y probably damaging Het
S1pr1 T A 3: 115,712,649 T99S probably benign Het
Serpinb9b G T 13: 33,035,548 V153F probably null Het
Sh2d3c A G 2: 32,725,264 E122G probably benign Het
Slc6a11 T A 6: 114,131,481 W69R probably damaging Het
Slco6c1 T A 1: 97,072,961 I539F probably damaging Het
Smgc G T 15: 91,849,119 probably null Het
Spata17 T C 1: 187,117,456 Y194C probably damaging Het
Tap1 A T 17: 34,193,319 probably null Het
Topbp1 T C 9: 103,320,541 S440P probably benign Het
Trpc6 T C 9: 8,609,981 L150P probably damaging Het
Ttll4 C T 1: 74,687,330 Q696* probably null Het
Ubash3b C T 9: 41,026,328 E447K probably damaging Het
Unc5cl T C 17: 48,467,410 S477P possibly damaging Het
Unc80 A G 1: 66,648,913 T2357A probably benign Het
Vmn1r58 A T 7: 5,410,342 S296R probably benign Het
Vmn2r85 G T 10: 130,425,951 N172K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yipf7 T A 5: 69,527,227 T82S probably benign Het
Zap70 A G 1: 36,781,206 S523G probably damaging Het
Zfp354a A G 11: 51,069,663 T233A probably benign Het
Other mutations in Rbm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rbm15 APN 3 107331010 missense probably damaging 0.98
IGL01933:Rbm15 APN 3 107331103 missense probably damaging 0.99
IGL02116:Rbm15 APN 3 107330280 missense probably damaging 1.00
IGL02886:Rbm15 APN 3 107326295 missense probably benign 0.41
R0281:Rbm15 UTSW 3 107331155 missense probably damaging 0.99
R0374:Rbm15 UTSW 3 107330564 missense probably damaging 1.00
R0376:Rbm15 UTSW 3 107330938 missense probably benign 0.00
R0501:Rbm15 UTSW 3 107332530 missense possibly damaging 0.91
R0517:Rbm15 UTSW 3 107331369 missense probably damaging 1.00
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1348:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1372:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1373:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1377:Rbm15 UTSW 3 107330758 missense probably benign
R1616:Rbm15 UTSW 3 107330881 missense probably benign
R1708:Rbm15 UTSW 3 107331220 missense probably damaging 1.00
R1944:Rbm15 UTSW 3 107331552 missense probably damaging 1.00
R2519:Rbm15 UTSW 3 107330833 missense probably benign 0.08
R3432:Rbm15 UTSW 3 107330677 missense probably benign 0.32
R4885:Rbm15 UTSW 3 107332254 missense probably benign 0.25
R5434:Rbm15 UTSW 3 107330467 missense possibly damaging 0.70
R6915:Rbm15 UTSW 3 107332311 missense probably benign 0.07
R7336:Rbm15 UTSW 3 107333116 start gained probably benign
R7799:Rbm15 UTSW 3 107332143 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTGCTGGTAACGATGTTC -3'
(R):5'- TGGACATTAAGAGGCCTTCTCG -3'

Sequencing Primer
(F):5'- AACGATGTTCTGTGTCTGCAAAGTC -3'
(R):5'- GAGGCCAGACCAGTACCTATG -3'
Posted On2020-06-30