Incidental Mutation 'R8115:Cad'
ID631126
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R8115 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31060927 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 452 (F452L)
Ref Sequence ENSEMBL: ENSMUSP00000013773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000201838] [ENSMUST00000202795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013773
AA Change: F452L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: F452L

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200953
AA Change: F452L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: F452L

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201182
AA Change: F452L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: F452L

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201838
AA Change: F452L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629
AA Change: F452L

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 6.3e-48 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 3.7e-86 PFAM
Pfam:ATP-grasp 522 690 2.5e-10 PFAM
Pfam:Dala_Dala_lig_C 526 687 4.2e-11 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
SCOP:d1a9xa3 935 964 1e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202795
AA Change: F452L

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: F452L

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T C 4: 35,218,763 Y32C Het
A1bg T G 15: 60,920,147 I211L probably benign Het
Abhd16b G A 2: 181,493,734 R143H possibly damaging Het
Abt1 T C 13: 23,422,232 E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,345,513 probably null Het
Asxl3 G A 18: 22,517,585 R877Q probably damaging Het
B3galt1 A G 2: 68,117,976 T12A possibly damaging Het
Bcat1 G A 6: 145,010,093 P354L probably damaging Het
Cadps2 T A 6: 23,328,898 I973F probably benign Het
Cenpq T C 17: 40,932,829 N43D probably damaging Het
Chd9 G T 8: 91,036,332 V2262L probably damaging Het
Cttnbp2nl G T 3: 105,006,086 Q161K probably damaging Het
D630003M21Rik A T 2: 158,216,590 H463Q probably benign Het
Defb1 C T 8: 21,794,484 H40Y probably benign Het
Dmrtb1 A T 4: 107,677,059 D186E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efr3a T A 15: 65,866,795 F758I probably damaging Het
Fap A G 2: 62,519,041 I501T probably benign Het
Galr3 C T 15: 79,043,324 R322* probably null Het
Hrnr C A 3: 93,323,732 R426S unknown Het
Hsp90ab1 A T 17: 45,569,275 M476K possibly damaging Het
Igsf3 G T 3: 101,455,279 R872L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqsec3 T G 6: 121,473,030 R178S unknown Het
Itgbl1 T C 14: 123,857,543 C327R probably damaging Het
Itsn2 A T 12: 4,673,602 Q1179L possibly damaging Het
Kcnb2 T C 1: 15,711,627 *908R probably null Het
Kdm5b G T 1: 134,619,673 W1020L possibly damaging Het
Kpna3 C A 14: 61,370,918 V364L probably damaging Het
Lsm14a T C 7: 34,375,237 I93V probably benign Het
Mast2 A G 4: 116,435,447 S109P probably benign Het
Muc4 G A 16: 32,755,304 S1726N unknown Het
Myo7a T C 7: 98,066,446 D1477G probably damaging Het
Nostrin G A 2: 69,180,920 probably null Het
Oasl1 T A 5: 114,936,937 V352E probably damaging Het
Olfr459 T A 6: 41,771,538 T254S probably benign Het
Pafah1b1 A G 11: 74,684,493 V195A probably damaging Het
Pcdhb4 G A 18: 37,309,400 V588M probably damaging Het
Pcsk5 A G 19: 17,510,166 probably null Het
Peg10 A G 6: 4,756,707 I428V unknown Het
Pmfbp1 G A 8: 109,537,037 V824M probably damaging Het
Prkag3 T C 1: 74,747,959 R47G possibly damaging Het
Prl8a1 T A 13: 27,574,045 H227L probably benign Het
Prune2 A G 19: 17,123,924 D2264G probably benign Het
Psg28 A G 7: 18,430,386 Y134H probably benign Het
Rab3gap2 T A 1: 185,267,250 Y1019N possibly damaging Het
Rbm15 A T 3: 107,331,650 F477L probably damaging Het
Ric1 A T 19: 29,586,573 N576Y probably damaging Het
S1pr1 T A 3: 115,712,649 T99S probably benign Het
Serpinb9b G T 13: 33,035,548 V153F probably null Het
Sh2d3c A G 2: 32,725,264 E122G probably benign Het
Slc6a11 T A 6: 114,131,481 W69R probably damaging Het
Slco6c1 T A 1: 97,072,961 I539F probably damaging Het
Smgc G T 15: 91,849,119 probably null Het
Spata17 T C 1: 187,117,456 Y194C probably damaging Het
Tap1 A T 17: 34,193,319 probably null Het
Topbp1 T C 9: 103,320,541 S440P probably benign Het
Trpc6 T C 9: 8,609,981 L150P probably damaging Het
Ttll4 C T 1: 74,687,330 Q696* probably null Het
Ubash3b C T 9: 41,026,328 E447K probably damaging Het
Unc5cl T C 17: 48,467,410 S477P possibly damaging Het
Unc80 A G 1: 66,648,913 T2357A probably benign Het
Vmn1r58 A T 7: 5,410,342 S296R probably benign Het
Vmn2r85 G T 10: 130,425,951 N172K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yipf7 T A 5: 69,527,227 T82S probably benign Het
Zap70 A G 1: 36,781,206 S523G probably damaging Het
Zfp354a A G 11: 51,069,663 T233A probably benign Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
PIT4696001:Cad UTSW 5 31072094 missense probably damaging 0.99
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 splice site probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
R7145:Cad UTSW 5 31067612 missense possibly damaging 0.89
R7303:Cad UTSW 5 31060213 critical splice donor site probably null
R7352:Cad UTSW 5 31058078 missense probably damaging 1.00
R7382:Cad UTSW 5 31075829 missense probably benign
R7387:Cad UTSW 5 31061940 missense probably damaging 1.00
R7455:Cad UTSW 5 31074162 missense probably damaging 0.99
R7596:Cad UTSW 5 31069048 missense probably benign
R7627:Cad UTSW 5 31060164 missense probably damaging 1.00
R7898:Cad UTSW 5 31061485 missense probably damaging 1.00
R8022:Cad UTSW 5 31068806 missense probably damaging 1.00
RF001:Cad UTSW 5 31060212 critical splice donor site probably benign
RF012:Cad UTSW 5 31060212 critical splice donor site probably benign
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Z1177:Cad UTSW 5 31068421 missense probably damaging 1.00
Z1177:Cad UTSW 5 31075128 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCCCATTGAGTCTTGAGCAG -3'
(R):5'- CACCATCTGGGCGTTCATTAC -3'

Sequencing Primer
(F):5'- GTCACTTACTGAGGACAGAGTAC -3'
(R):5'- GTTCATTACGAATTACCTGAGGCAGG -3'
Posted On2020-06-30