Incidental Mutation 'R8115:Dsc2'
ID 631165
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 067544-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8115 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20165331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,996 (GRCm39) I211L probably benign Het
Abhd16b G A 2: 181,135,527 (GRCm39) R143H possibly damaging Het
Abt1 T C 13: 23,606,402 (GRCm39) E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,322,498 (GRCm39) probably null Het
Asxl3 G A 18: 22,650,642 (GRCm39) R877Q probably damaging Het
B3galt1 A G 2: 67,948,320 (GRCm39) T12A possibly damaging Het
Bcat1 G A 6: 144,955,819 (GRCm39) P354L probably damaging Het
C9orf72 T C 4: 35,218,763 (GRCm39) Y32C Het
Cad T C 5: 31,218,271 (GRCm39) F452L possibly damaging Het
Cadps2 T A 6: 23,328,897 (GRCm39) I973F probably benign Het
Cenpq T C 17: 41,243,720 (GRCm39) N43D probably damaging Het
Chd9 G T 8: 91,762,960 (GRCm39) V2262L probably damaging Het
Cttnbp2nl G T 3: 104,913,402 (GRCm39) Q161K probably damaging Het
D630003M21Rik A T 2: 158,058,510 (GRCm39) H463Q probably benign Het
Defb1 C T 8: 22,284,500 (GRCm39) H40Y probably benign Het
Dmrtb1 A T 4: 107,534,256 (GRCm39) D186E probably benign Het
Efr3a T A 15: 65,738,644 (GRCm39) F758I probably damaging Het
Fap A G 2: 62,349,385 (GRCm39) I501T probably benign Het
Galr3 C T 15: 78,927,524 (GRCm39) R322* probably null Het
Hrnr C A 3: 93,231,039 (GRCm39) R426S unknown Het
Hsp90ab1 A T 17: 45,880,201 (GRCm39) M476K possibly damaging Het
Igsf3 G T 3: 101,362,595 (GRCm39) R872L probably benign Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Iqsec3 T G 6: 121,449,989 (GRCm39) R178S unknown Het
Itgbl1 T C 14: 124,094,955 (GRCm39) C327R probably damaging Het
Itsn2 A T 12: 4,723,602 (GRCm39) Q1179L possibly damaging Het
Kcnb2 T C 1: 15,781,851 (GRCm39) *908R probably null Het
Kdm5b G T 1: 134,547,411 (GRCm39) W1020L possibly damaging Het
Kpna3 C A 14: 61,608,367 (GRCm39) V364L probably damaging Het
Lsm14a T C 7: 34,074,662 (GRCm39) I93V probably benign Het
Mast2 A G 4: 116,292,644 (GRCm39) S109P probably benign Het
Muc4 G A 16: 32,575,678 (GRCm39) S1726N unknown Het
Myo7a T C 7: 97,715,653 (GRCm39) D1477G probably damaging Het
Nostrin G A 2: 69,011,264 (GRCm39) probably null Het
Oasl1 T A 5: 115,074,996 (GRCm39) V352E probably damaging Het
Or9a2 T A 6: 41,748,472 (GRCm39) T254S probably benign Het
Pafah1b1 A G 11: 74,575,319 (GRCm39) V195A probably damaging Het
Pcdhb4 G A 18: 37,442,453 (GRCm39) V588M probably damaging Het
Pcsk5 A G 19: 17,487,530 (GRCm39) probably null Het
Peg10 A G 6: 4,756,707 (GRCm39) I428V unknown Het
Pmfbp1 G A 8: 110,263,669 (GRCm39) V824M probably damaging Het
Prkag3 T C 1: 74,787,118 (GRCm39) R47G possibly damaging Het
Prl8a1 T A 13: 27,758,028 (GRCm39) H227L probably benign Het
Prune2 A G 19: 17,101,288 (GRCm39) D2264G probably benign Het
Psg28 A G 7: 18,164,311 (GRCm39) Y134H probably benign Het
Rab3gap2 T A 1: 184,999,447 (GRCm39) Y1019N possibly damaging Het
Rbm15 A T 3: 107,238,966 (GRCm39) F477L probably damaging Het
Ric1 A T 19: 29,563,973 (GRCm39) N576Y probably damaging Het
S1pr1 T A 3: 115,506,298 (GRCm39) T99S probably benign Het
Serpinb9b G T 13: 33,219,531 (GRCm39) V153F probably null Het
Sh2d3c A G 2: 32,615,276 (GRCm39) E122G probably benign Het
Slc6a11 T A 6: 114,108,442 (GRCm39) W69R probably damaging Het
Slco6c1 T A 1: 97,000,686 (GRCm39) I539F probably damaging Het
Smgc G T 15: 91,733,322 (GRCm39) probably null Het
Spata17 T C 1: 186,849,653 (GRCm39) Y194C probably damaging Het
Tap1 A T 17: 34,412,293 (GRCm39) probably null Het
Topbp1 T C 9: 103,197,740 (GRCm39) S440P probably benign Het
Trpc6 T C 9: 8,609,982 (GRCm39) L150P probably damaging Het
Ttll4 C T 1: 74,726,489 (GRCm39) Q696* probably null Het
Ubash3b C T 9: 40,937,624 (GRCm39) E447K probably damaging Het
Unc5cl T C 17: 48,774,438 (GRCm39) S477P possibly damaging Het
Unc80 A G 1: 66,688,072 (GRCm39) T2357A probably benign Het
Vmn1r58 A T 7: 5,413,341 (GRCm39) S296R probably benign Het
Vmn2r85 G T 10: 130,261,820 (GRCm39) N172K probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Yipf7 T A 5: 69,684,570 (GRCm39) T82S probably benign Het
Zap70 A G 1: 36,820,287 (GRCm39) S523G probably damaging Het
Zfp354a A G 11: 50,960,490 (GRCm39) T233A probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On 2020-06-30