Mutagenetix > Incidental Mutation

Incidental Mutation 'R8115:Dsc2'

631165

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8115 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20032274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 881 (G881R)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably benign
Transcript: ENSMUST00000039247

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.1423

Coding Region Coverage

1x: 99.7%
3x: 99.5%
10x: 98.4%
20x: 94.2%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	T	C	4: 35,218,763	Y32C		Het
A1bg	T	G	15: 60,920,147	I211L	probably benign	Het
Abhd16b	G	A	2: 181,493,734	R143H	possibly damaging	Het
Abt1	T	C	13: 23,422,232	E184G	probably damaging	Het
Aqp1	AGG	AGGG	6: 55,345,513		probably null	Het
Asxl3	G	A	18: 22,517,585	R877Q	probably damaging	Het
B3galt1	A	G	2: 68,117,976	T12A	possibly damaging	Het
Bcat1	G	A	6: 145,010,093	P354L	probably damaging	Het
Cad	T	C	5: 31,060,927	F452L	possibly damaging	Het
Cadps2	T	A	6: 23,328,898	I973F	probably benign	Het
Cenpq	T	C	17: 40,932,829	N43D	probably damaging	Het
Chd9	G	T	8: 91,036,332	V2262L	probably damaging	Het
Cttnbp2nl	G	T	3: 105,006,086	Q161K	probably damaging	Het
D630003M21Rik	A	T	2: 158,216,590	H463Q	probably benign	Het
Defb1	C	T	8: 21,794,484	H40Y	probably benign	Het
Dmrtb1	A	T	4: 107,677,059	D186E	probably benign	Het
Efr3a	T	A	15: 65,866,795	F758I	probably damaging	Het
Fap	A	G	2: 62,519,041	I501T	probably benign	Het
Galr3	C	T	15: 79,043,324	R322*	probably null	Het
Hrnr	C	A	3: 93,323,732	R426S	unknown	Het
Hsp90ab1	A	T	17: 45,569,275	M476K	possibly damaging	Het
Igsf3	G	T	3: 101,455,279	R872L	probably benign	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Iqsec3	T	G	6: 121,473,030	R178S	unknown	Het
Itgbl1	T	C	14: 123,857,543	C327R	probably damaging	Het
Itsn2	A	T	12: 4,673,602	Q1179L	possibly damaging	Het
Kcnb2	T	C	1: 15,711,627	*908R	probably null	Het
Kdm5b	G	T	1: 134,619,673	W1020L	possibly damaging	Het
Kpna3	C	A	14: 61,370,918	V364L	probably damaging	Het
Lsm14a	T	C	7: 34,375,237	I93V	probably benign	Het
Mast2	A	G	4: 116,435,447	S109P	probably benign	Het
Muc4	G	A	16: 32,755,304	S1726N	unknown	Het
Myo7a	T	C	7: 98,066,446	D1477G	probably damaging	Het
Nostrin	G	A	2: 69,180,920		probably null	Het
Oasl1	T	A	5: 114,936,937	V352E	probably damaging	Het
Olfr459	T	A	6: 41,771,538	T254S	probably benign	Het
Pafah1b1	A	G	11: 74,684,493	V195A	probably damaging	Het
Pcdhb4	G	A	18: 37,309,400	V588M	probably damaging	Het
Pcsk5	A	G	19: 17,510,166		probably null	Het
Peg10	A	G	6: 4,756,707	I428V	unknown	Het
Pmfbp1	G	A	8: 109,537,037	V824M	probably damaging	Het
Prkag3	T	C	1: 74,747,959	R47G	possibly damaging	Het
Prl8a1	T	A	13: 27,574,045	H227L	probably benign	Het
Prune2	A	G	19: 17,123,924	D2264G	probably benign	Het
Psg28	A	G	7: 18,430,386	Y134H	probably benign	Het
Rab3gap2	T	A	1: 185,267,250	Y1019N	possibly damaging	Het
Rbm15	A	T	3: 107,331,650	F477L	probably damaging	Het
Ric1	A	T	19: 29,586,573	N576Y	probably damaging	Het
S1pr1	T	A	3: 115,712,649	T99S	probably benign	Het
Serpinb9b	G	T	13: 33,035,548	V153F	probably null	Het
Sh2d3c	A	G	2: 32,725,264	E122G	probably benign	Het
Slc6a11	T	A	6: 114,131,481	W69R	probably damaging	Het
Slco6c1	T	A	1: 97,072,961	I539F	probably damaging	Het
Smgc	G	T	15: 91,849,119		probably null	Het
Spata17	T	C	1: 187,117,456	Y194C	probably damaging	Het
Tap1	A	T	17: 34,193,319		probably null	Het
Topbp1	T	C	9: 103,320,541	S440P	probably benign	Het
Trpc6	T	C	9: 8,609,981	L150P	probably damaging	Het
Ttll4	C	T	1: 74,687,330	Q696*	probably null	Het
Ubash3b	C	T	9: 41,026,328	E447K	probably damaging	Het
Unc5cl	T	C	17: 48,467,410	S477P	possibly damaging	Het
Unc80	A	G	1: 66,648,913	T2357A	probably benign	Het
Vmn1r58	A	T	7: 5,410,342	S296R	probably benign	Het
Vmn2r85	G	T	10: 130,425,951	N172K	probably benign	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Yipf7	T	A	5: 69,527,227	T82S	probably benign	Het
Zap70	A	G	1: 36,781,206	S523G	probably damaging	Het
Zfp354a	A	G	11: 51,069,663	T233A	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'

Posted On

2020-06-30