Incidental Mutation 'R0705:Hpgd'
ID63117
Institutional Source Beutler Lab
Gene Symbol Hpgd
Ensembl Gene ENSMUSG00000031613
Gene Namehydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms15-PGDH
MMRRC Submission 038888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0705 (G1)
Quality Score150
Status Not validated
Chromosome8
Chromosomal Location56294585-56321043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56295039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 65 (V65A)
Ref Sequence ENSEMBL: ENSMUSP00000034026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034026]
Predicted Effect probably damaging
Transcript: ENSMUST00000034026
AA Change: V65A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034026
Gene: ENSMUSG00000031613
AA Change: V65A

DomainStartEndE-ValueType
Pfam:KR 6 175 6.6e-11 PFAM
Pfam:adh_short 6 199 1.7e-59 PFAM
Pfam:adh_short_C2 12 252 1.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutation of this gene results failure of the ductus arteriosus to close and perinatal lethality. Mutant animals die within 12-48 hours after birth due to congestive heart failure. Mice homozygous for a hypomorphic allele exhibit preterm labor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,885,366 probably null Het
Asic4 G T 1: 75,451,370 C180F probably damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Crebbp A C 16: 4,155,010 S273R possibly damaging Het
Dpy19l3 T A 7: 35,695,316 Y599F probably damaging Het
Fam234b A T 6: 135,227,215 D452V probably benign Het
Fbxw22 G T 9: 109,403,096 H78N possibly damaging Het
Impg1 A T 9: 80,379,979 L395Q probably damaging Het
Kcnq5 A G 1: 21,535,177 M168T probably damaging Het
Spink5 T A 18: 43,992,274 M403K probably benign Het
Ssxb9 T G X: 8,371,783 S130R probably damaging Het
Other mutations in Hpgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Hpgd APN 8 56319062 missense probably benign 0.04
R0703:Hpgd UTSW 8 56295039 missense probably damaging 1.00
R1138:Hpgd UTSW 8 56307677 missense probably benign 0.00
R2081:Hpgd UTSW 8 56307642 missense probably benign
R3177:Hpgd UTSW 8 56298413 missense probably damaging 1.00
R3277:Hpgd UTSW 8 56298413 missense probably damaging 1.00
R3782:Hpgd UTSW 8 56298418 missense probably damaging 1.00
R4774:Hpgd UTSW 8 56298419 missense probably damaging 1.00
R4874:Hpgd UTSW 8 56317803 missense possibly damaging 0.78
R5501:Hpgd UTSW 8 56298356 missense probably benign 0.04
R5828:Hpgd UTSW 8 56319071 missense probably benign 0.10
R5846:Hpgd UTSW 8 56307667 missense possibly damaging 0.90
R6136:Hpgd UTSW 8 56294952 missense probably damaging 1.00
R7252:Hpgd UTSW 8 56298426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCCGAACTTGGATGAGCAC -3'
(R):5'- GCTCTCTGAGAACTGCTTGCCATAG -3'

Sequencing Primer
(F):5'- CGAACTTGGATGAGCACATTCTG -3'
(R):5'- GTAGCAGCACTGTCTTCGAATAC -3'
Posted On2013-07-30