Incidental Mutation 'R8116:H13'
ID631185
Institutional Source Beutler Lab
Gene Symbol H13
Ensembl Gene ENSMUSG00000019188
Gene Namehistocompatibility 13
SynonymsSpp, 1200006O09Rik, H-13, 5031424B04Rik, 4930443L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8116 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152669461-152708670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152695526 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 297 (A297V)
Ref Sequence ENSEMBL: ENSMUSP00000086460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079247] [ENSMUST00000089059] [ENSMUST00000125366]
PDB Structure
Structure of Minor Histocompatibility Antigen peptide, H13a, complexed to H2-Db [X-RAY DIFFRACTION]
Structure of Minor Histocompatibility Antigen peptide, H13b, complexed to H2-Db [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000079247
AA Change: A255V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078236
Gene: ENSMUSG00000019188
AA Change: A255V

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
PSN 66 295 1.74e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089059
AA Change: A297V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086460
Gene: ENSMUSG00000019188
AA Change: A297V

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125366
AA Change: A297V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120068
Gene: ENSMUSG00000019188
AA Change: A297V

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
low complexity region 355 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: This is one of several loci identified by development of congenic strains differing in resistance to transplantable tumors. C57BL/10 carries the a allele and B10.129(14M) carries the b allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,091,594 N7K probably benign Het
Akap9 T A 5: 4,061,183 D3081E probably benign Het
Amer2 G A 14: 60,379,405 A350T probably damaging Het
Amotl1 A G 9: 14,555,572 probably null Het
Ankib1 A T 5: 3,702,995 V651E probably damaging Het
Aox1 T C 1: 58,076,124 V756A probably damaging Het
Arap2 A C 5: 62,730,611 I464S probably benign Het
Atp8a2 A C 14: 60,026,208 M359R probably damaging Het
Aunip T C 4: 134,523,307 S188P possibly damaging Het
Cdt1 A G 8: 122,571,989 E455G probably benign Het
Cyp2r1 G T 7: 114,550,355 H475N probably benign Het
Dnah7a G T 1: 53,503,890 H2374N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dst G A 1: 34,274,180 A4343T probably benign Het
Efcab3 A G 11: 105,111,851 D304G possibly damaging Het
Efcc1 T C 6: 87,751,790 L409P probably damaging Het
Eno1 G T 4: 150,241,069 S37I probably damaging Het
Ermp1 A T 19: 29,623,796 L517Q probably damaging Het
Farp1 T G 14: 121,233,820 I196S probably damaging Het
Fbxo21 A G 5: 117,990,854 T310A possibly damaging Het
Fbxo31 C T 8: 121,560,388 V149M probably damaging Het
Ggcx C A 6: 72,429,528 T658N possibly damaging Het
Gm884 A T 11: 103,543,289 M3018K unknown Het
Gpc5 A C 14: 115,399,225 H440P probably damaging Het
H2-DMb1 T A 17: 34,155,469 L31Q probably damaging Het
Ifi207 G A 1: 173,730,180 P331S unknown Het
Il11ra1 G T 4: 41,766,251 A263S probably benign Het
Il1a C A 2: 129,302,944 V185F probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kdm4d T A 9: 14,463,941 K207M probably damaging Het
Lrrc4b T C 7: 44,461,109 L135P probably damaging Het
Lrrk1 A G 7: 66,262,623 Y1730H possibly damaging Het
Mcpt2 C A 14: 56,042,206 A18D probably damaging Het
Mtmr4 C T 11: 87,611,930 R937* probably null Het
Muc16 T A 9: 18,658,737 T829S unknown Het
Mum1 G A 10: 80,240,397 G474S probably damaging Het
Myof A C 19: 37,932,719 I1365S probably damaging Het
Npc2 C T 12: 84,760,838 R82Q probably benign Het
Olfr1123 T A 2: 87,418,737 S228T probably damaging Het
Olfr117 G A 17: 37,659,740 L198F probably damaging Het
Olfr1295 T C 2: 111,565,438 D2G probably benign Het
Olfr418 T A 1: 173,270,480 F102I possibly damaging Het
Olfr918 A T 9: 38,673,168 I92N possibly damaging Het
Olfr926 T A 9: 38,877,730 S185T probably damaging Het
Olfr934 A T 9: 38,982,873 M57K probably damaging Het
Pdzph1 T C 17: 58,975,143 N48S probably benign Het
Plce1 A T 19: 38,524,818 H187L probably benign Het
Pramel6 G T 2: 87,508,464 V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,797,574 probably null Het
Rabgap1l A G 1: 160,702,442 Y358H probably benign Het
Rbbp8 T C 18: 11,722,670 S625P probably damaging Het
Rhot1 A T 11: 80,251,053 K461I probably benign Het
Rpa1 G A 11: 75,302,675 T610I possibly damaging Het
Ryr1 G T 7: 29,110,883 H316N probably benign Het
Shprh T C 10: 11,213,461 S1648P probably damaging Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Spata6 A G 4: 111,828,320 Y474C possibly damaging Het
Sptbn1 A T 11: 30,139,117 I715N probably damaging Het
Stab1 A T 14: 31,158,953 D627E possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tfpi2 T C 6: 3,963,872 T187A probably damaging Het
Tmem63a G T 1: 180,960,483 K267N probably benign Het
Topaz1 C T 9: 122,775,643 A1104V probably benign Het
Trmt11 A G 10: 30,566,494 I231T possibly damaging Het
Utp15 G A 13: 98,250,863 T401I probably benign Het
Vmn2r13 T C 5: 109,175,060 K121R probably benign Het
Xab2 C T 8: 3,613,830 R363H probably damaging Het
Zfand2b T A 1: 75,168,860 F3L possibly damaging Het
Zfyve28 A T 5: 34,217,600 S357T probably damaging Het
Other mutations in H13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:H13 APN 2 152688682 missense probably damaging 0.98
R0100:H13 UTSW 2 152689863 splice site probably null
R0100:H13 UTSW 2 152689863 splice site probably null
R0106:H13 UTSW 2 152686256 missense probably benign 0.09
R0178:H13 UTSW 2 152681067 missense probably damaging 1.00
R2880:H13 UTSW 2 152695561 missense probably damaging 1.00
R4058:H13 UTSW 2 152691874 missense probably damaging 1.00
R4110:H13 UTSW 2 152681109 missense probably damaging 0.99
R4397:H13 UTSW 2 152677552 missense probably damaging 0.98
R5698:H13 UTSW 2 152688955 missense probably damaging 1.00
R7145:H13 UTSW 2 152681072 missense probably damaging 1.00
R7773:H13 UTSW 2 152695511 missense probably damaging 1.00
R8192:H13 UTSW 2 152669602 missense probably benign
R8362:H13 UTSW 2 152686391 missense unknown
R8409:H13 UTSW 2 152689893 missense possibly damaging 0.94
RF005:H13 UTSW 2 152669669 missense probably damaging 1.00
RF008:H13 UTSW 2 152669669 missense probably damaging 1.00
RF016:H13 UTSW 2 152669669 missense probably damaging 1.00
RF019:H13 UTSW 2 152669669 missense probably damaging 1.00
RF023:H13 UTSW 2 152669669 missense probably damaging 1.00
RF024:H13 UTSW 2 152669669 missense probably damaging 1.00
X0019:H13 UTSW 2 152681070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTATCTAAAGAGACATAGCTCAGGG -3'
(R):5'- ATGAAGACAGTGCTTGTGGC -3'

Sequencing Primer
(F):5'- ACATAGCTCAGGGAAGGCC -3'
(R):5'- GCTTGTGGCAGCAGCTG -3'
Posted On2020-06-30