Incidental Mutation 'R8116:Utp15'
ID 631225
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene Name UTP15 small subunit processome component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R8116 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 98246845-98263041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 98250863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 401 (T401I)
Ref Sequence ENSEMBL: ENSMUSP00000048204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040972]
AlphaFold Q8C7V3
Predicted Effect probably benign
Transcript: ENSMUST00000040972
AA Change: T401I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: T401I

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,091,594 N7K probably benign Het
Akap9 T A 5: 4,061,183 D3081E probably benign Het
Amer2 G A 14: 60,379,405 A350T probably damaging Het
Amotl1 A G 9: 14,555,572 probably null Het
Ankib1 A T 5: 3,702,995 V651E probably damaging Het
Aox1 T C 1: 58,076,124 V756A probably damaging Het
Arap2 A C 5: 62,730,611 I464S probably benign Het
Atp8a2 A C 14: 60,026,208 M359R probably damaging Het
Aunip T C 4: 134,523,307 S188P possibly damaging Het
Cdt1 A G 8: 122,571,989 E455G probably benign Het
Cyp2r1 G T 7: 114,550,355 H475N probably benign Het
Dnah7a G T 1: 53,503,890 H2374N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dst G A 1: 34,274,180 A4343T probably benign Het
Efcab3 A G 11: 105,111,851 D304G possibly damaging Het
Efcc1 T C 6: 87,751,790 L409P probably damaging Het
Eno1 G T 4: 150,241,069 S37I probably damaging Het
Ermp1 A T 19: 29,623,796 L517Q probably damaging Het
Farp1 T G 14: 121,233,820 I196S probably damaging Het
Fbxo21 A G 5: 117,990,854 T310A possibly damaging Het
Fbxo31 C T 8: 121,560,388 V149M probably damaging Het
Ggcx C A 6: 72,429,528 T658N possibly damaging Het
Gm884 A T 11: 103,543,289 M3018K unknown Het
Gpc5 A C 14: 115,399,225 H440P probably damaging Het
H13 C T 2: 152,695,526 A297V probably damaging Het
H2-DMb1 T A 17: 34,155,469 L31Q probably damaging Het
Ifi207 G A 1: 173,730,180 P331S unknown Het
Il11ra1 G T 4: 41,766,251 A263S probably benign Het
Il1a C A 2: 129,302,944 V185F probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kdm4d T A 9: 14,463,941 K207M probably damaging Het
Lrrc4b T C 7: 44,461,109 L135P probably damaging Het
Lrrk1 A G 7: 66,262,623 Y1730H possibly damaging Het
Mcpt2 C A 14: 56,042,206 A18D probably damaging Het
Mtmr4 C T 11: 87,611,930 R937* probably null Het
Muc16 T A 9: 18,658,737 T829S unknown Het
Mum1 G A 10: 80,240,397 G474S probably damaging Het
Myof A C 19: 37,932,719 I1365S probably damaging Het
Npc2 C T 12: 84,760,838 R82Q probably benign Het
Olfr1123 T A 2: 87,418,737 S228T probably damaging Het
Olfr117 G A 17: 37,659,740 L198F probably damaging Het
Olfr1295 T C 2: 111,565,438 D2G probably benign Het
Olfr418 T A 1: 173,270,480 F102I possibly damaging Het
Olfr918 A T 9: 38,673,168 I92N possibly damaging Het
Olfr926 T A 9: 38,877,730 S185T probably damaging Het
Olfr934 A T 9: 38,982,873 M57K probably damaging Het
Pdzph1 T C 17: 58,975,143 N48S probably benign Het
Plce1 A T 19: 38,524,818 H187L probably benign Het
Pramel6 G T 2: 87,508,464 V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,797,574 probably null Het
Rabgap1l A G 1: 160,702,442 Y358H probably benign Het
Rbbp8 T C 18: 11,722,670 S625P probably damaging Het
Rhot1 A T 11: 80,251,053 K461I probably benign Het
Rpa1 G A 11: 75,302,675 T610I possibly damaging Het
Ryr1 G T 7: 29,110,883 H316N probably benign Het
Shprh T C 10: 11,213,461 S1648P probably damaging Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Spata6 A G 4: 111,828,320 Y474C possibly damaging Het
Sptbn1 A T 11: 30,139,117 I715N probably damaging Het
Stab1 A T 14: 31,158,953 D627E possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tfpi2 T C 6: 3,963,872 T187A probably damaging Het
Tmem63a G T 1: 180,960,483 K267N probably benign Het
Topaz1 C T 9: 122,775,643 A1104V probably benign Het
Trmt11 A G 10: 30,566,494 I231T possibly damaging Het
Vmn2r13 T C 5: 109,175,060 K121R probably benign Het
Xab2 C T 8: 3,613,830 R363H probably damaging Het
Zfand2b T A 1: 75,168,860 F3L possibly damaging Het
Zfyve28 A T 5: 34,217,600 S357T probably damaging Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0125:Utp15 UTSW 13 98250882 missense possibly damaging 0.81
R0679:Utp15 UTSW 13 98259403 missense probably benign 0.13
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R2263:Utp15 UTSW 13 98257925 missense probably benign 0.03
R3888:Utp15 UTSW 13 98259166 missense probably benign 0.00
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5436:Utp15 UTSW 13 98260846 splice site probably null
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R6489:Utp15 UTSW 13 98250609 missense probably damaging 0.96
R8360:Utp15 UTSW 13 98254991 missense probably damaging 1.00
R9049:Utp15 UTSW 13 98259270 missense probably damaging 1.00
R9370:Utp15 UTSW 13 98250611 missense probably damaging 0.96
R9654:Utp15 UTSW 13 98249160 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATTCCTGCAGAGCAAAACTTC -3'
(R):5'- AAACCTGGGGCTAGGACATG -3'

Sequencing Primer
(F):5'- GACTTTTGTAAGCCTCACAAAAAG -3'
(R):5'- CTAGGACATGTGGGGGATCC -3'
Posted On 2020-06-30