Incidental Mutation 'R0705:Ssxb9'
ID63123
Institutional Source Beutler Lab
Gene Symbol Ssxb9
Ensembl Gene ENSMUSG00000068218
Gene Namesynovial sarcoma, X member B9
Synonyms
MMRRC Submission 038888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R0705 (G1)
Quality Score113
Status Not validated
ChromosomeX
Chromosomal Location8366978-8375390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 8371783 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 130 (S130R)
Ref Sequence ENSEMBL: ENSMUSP00000111247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115584]
Predicted Effect probably damaging
Transcript: ENSMUST00000115584
AA Change: S130R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111247
Gene: ENSMUSG00000068218
AA Change: S130R

DomainStartEndE-ValueType
KRAB 38 97 1.19e-7 SMART
Pfam:SSXRD 150 182 2.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,885,366 probably null Het
Asic4 G T 1: 75,451,370 C180F probably damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Crebbp A C 16: 4,155,010 S273R possibly damaging Het
Dpy19l3 T A 7: 35,695,316 Y599F probably damaging Het
Fam234b A T 6: 135,227,215 D452V probably benign Het
Fbxw22 G T 9: 109,403,096 H78N possibly damaging Het
Hpgd T C 8: 56,295,039 V65A probably damaging Het
Impg1 A T 9: 80,379,979 L395Q probably damaging Het
Kcnq5 A G 1: 21,535,177 M168T probably damaging Het
Spink5 T A 18: 43,992,274 M403K probably benign Het
Other mutations in Ssxb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Ssxb9 APN X 21174995 missense probably benign 0.00
R0704:Ssxb9 UTSW X 8371783 missense probably damaging 1.00
R4133:Ssxb9 UTSW X 8369606 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTCACATGCTGTTTCAAATGCC -3'
(R):5'- GTGGACCTGCTCTTTGGGTCAATAATC -3'

Sequencing Primer
(F):5'- GCTGTTTCAAATGCCAATTTTTACTG -3'
(R):5'- attggatgaaagggtgggg -3'
Posted On2013-07-30