Incidental Mutation 'R8116:Farp1'
ID631231
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8116 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121233820 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 196 (I196S)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635] [ENSMUST00000135010]
Predicted Effect probably damaging
Transcript: ENSMUST00000026635
AA Change: I196S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: I196S

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135010
AA Change: I196S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116985
Gene: ENSMUSG00000025555
AA Change: I196S

DomainStartEndE-ValueType
B41 36 210 3.4e-48 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,091,594 N7K probably benign Het
Akap9 T A 5: 4,061,183 D3081E probably benign Het
Amer2 G A 14: 60,379,405 A350T probably damaging Het
Amotl1 A G 9: 14,555,572 probably null Het
Ankib1 A T 5: 3,702,995 V651E probably damaging Het
Aox1 T C 1: 58,076,124 V756A probably damaging Het
Arap2 A C 5: 62,730,611 I464S probably benign Het
Atp8a2 A C 14: 60,026,208 M359R probably damaging Het
Aunip T C 4: 134,523,307 S188P possibly damaging Het
Cdt1 A G 8: 122,571,989 E455G probably benign Het
Cyp2r1 G T 7: 114,550,355 H475N probably benign Het
Dnah7a G T 1: 53,503,890 H2374N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dst G A 1: 34,274,180 A4343T probably benign Het
Efcab3 A G 11: 105,111,851 D304G possibly damaging Het
Efcc1 T C 6: 87,751,790 L409P probably damaging Het
Eno1 G T 4: 150,241,069 S37I probably damaging Het
Ermp1 A T 19: 29,623,796 L517Q probably damaging Het
Fbxo21 A G 5: 117,990,854 T310A possibly damaging Het
Fbxo31 C T 8: 121,560,388 V149M probably damaging Het
Ggcx C A 6: 72,429,528 T658N possibly damaging Het
Gm884 A T 11: 103,543,289 M3018K unknown Het
Gpc5 A C 14: 115,399,225 H440P probably damaging Het
H13 C T 2: 152,695,526 A297V probably damaging Het
H2-DMb1 T A 17: 34,155,469 L31Q probably damaging Het
Ifi207 G A 1: 173,730,180 P331S unknown Het
Il11ra1 G T 4: 41,766,251 A263S probably benign Het
Il1a C A 2: 129,302,944 V185F probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kdm4d T A 9: 14,463,941 K207M probably damaging Het
Lrrc4b T C 7: 44,461,109 L135P probably damaging Het
Lrrk1 A G 7: 66,262,623 Y1730H possibly damaging Het
Mcpt2 C A 14: 56,042,206 A18D probably damaging Het
Mtmr4 C T 11: 87,611,930 R937* probably null Het
Muc16 T A 9: 18,658,737 T829S unknown Het
Mum1 G A 10: 80,240,397 G474S probably damaging Het
Myof A C 19: 37,932,719 I1365S probably damaging Het
Npc2 C T 12: 84,760,838 R82Q probably benign Het
Olfr1123 T A 2: 87,418,737 S228T probably damaging Het
Olfr117 G A 17: 37,659,740 L198F probably damaging Het
Olfr1295 T C 2: 111,565,438 D2G probably benign Het
Olfr418 T A 1: 173,270,480 F102I possibly damaging Het
Olfr918 A T 9: 38,673,168 I92N possibly damaging Het
Olfr926 T A 9: 38,877,730 S185T probably damaging Het
Olfr934 A T 9: 38,982,873 M57K probably damaging Het
Pdzph1 T C 17: 58,975,143 N48S probably benign Het
Plce1 A T 19: 38,524,818 H187L probably benign Het
Pramel6 G T 2: 87,508,464 V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,797,574 probably null Het
Rabgap1l A G 1: 160,702,442 Y358H probably benign Het
Rbbp8 T C 18: 11,722,670 S625P probably damaging Het
Rhot1 A T 11: 80,251,053 K461I probably benign Het
Rpa1 G A 11: 75,302,675 T610I possibly damaging Het
Ryr1 G T 7: 29,110,883 H316N probably benign Het
Shprh T C 10: 11,213,461 S1648P probably damaging Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Spata6 A G 4: 111,828,320 Y474C possibly damaging Het
Sptbn1 A T 11: 30,139,117 I715N probably damaging Het
Stab1 A T 14: 31,158,953 D627E possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tfpi2 T C 6: 3,963,872 T187A probably damaging Het
Tmem63a G T 1: 180,960,483 K267N probably benign Het
Topaz1 C T 9: 122,775,643 A1104V probably benign Het
Trmt11 A G 10: 30,566,494 I231T possibly damaging Het
Utp15 G A 13: 98,250,863 T401I probably benign Het
Vmn2r13 T C 5: 109,175,060 K121R probably benign Het
Xab2 C T 8: 3,613,830 R363H probably damaging Het
Zfand2b T A 1: 75,168,860 F3L possibly damaging Het
Zfyve28 A T 5: 34,217,600 S357T probably damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8716:Farp1 UTSW 14 121242443 missense probably benign
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCCAGGGATTGTAACAC -3'
(R):5'- TGTGTGTATGCGAGCTCACG -3'

Sequencing Primer
(F):5'- GCCCAGGGATTGTAACACATTCTG -3'
(R):5'- CTCCCTGTGCCAGTGTGTG -3'
Posted On2020-06-30