Incidental Mutation 'R8116:Olfr117'
ID631233
Institutional Source Beutler Lab
Gene Symbol Olfr117
Ensembl Gene ENSMUSG00000095286
Gene Nameolfactory receptor 117
SynonymsGA_x6K02T2PSCP-2119438-2118485, MOR256-33
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8116 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37657600-37663782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37659740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 198 (L198F)
Ref Sequence ENSEMBL: ENSMUSP00000150204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073636] [ENSMUST00000213638] [ENSMUST00000215414]
Predicted Effect probably damaging
Transcript: ENSMUST00000073636
AA Change: L198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073320
Gene: ENSMUSG00000095286
AA Change: L198F

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 222 2e-5 PFAM
Pfam:7tm_1 40 289 2.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213638
AA Change: L198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215414
AA Change: L198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,091,594 N7K probably benign Het
Akap9 T A 5: 4,061,183 D3081E probably benign Het
Amer2 G A 14: 60,379,405 A350T probably damaging Het
Amotl1 A G 9: 14,555,572 probably null Het
Ankib1 A T 5: 3,702,995 V651E probably damaging Het
Aox1 T C 1: 58,076,124 V756A probably damaging Het
Arap2 A C 5: 62,730,611 I464S probably benign Het
Atp8a2 A C 14: 60,026,208 M359R probably damaging Het
Aunip T C 4: 134,523,307 S188P possibly damaging Het
Cdt1 A G 8: 122,571,989 E455G probably benign Het
Cyp2r1 G T 7: 114,550,355 H475N probably benign Het
Dnah7a G T 1: 53,503,890 H2374N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dst G A 1: 34,274,180 A4343T probably benign Het
Efcab3 A G 11: 105,111,851 D304G possibly damaging Het
Efcc1 T C 6: 87,751,790 L409P probably damaging Het
Eno1 G T 4: 150,241,069 S37I probably damaging Het
Ermp1 A T 19: 29,623,796 L517Q probably damaging Het
Farp1 T G 14: 121,233,820 I196S probably damaging Het
Fbxo21 A G 5: 117,990,854 T310A possibly damaging Het
Fbxo31 C T 8: 121,560,388 V149M probably damaging Het
Ggcx C A 6: 72,429,528 T658N possibly damaging Het
Gm884 A T 11: 103,543,289 M3018K unknown Het
Gpc5 A C 14: 115,399,225 H440P probably damaging Het
H13 C T 2: 152,695,526 A297V probably damaging Het
H2-DMb1 T A 17: 34,155,469 L31Q probably damaging Het
Ifi207 G A 1: 173,730,180 P331S unknown Het
Il11ra1 G T 4: 41,766,251 A263S probably benign Het
Il1a C A 2: 129,302,944 V185F probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kdm4d T A 9: 14,463,941 K207M probably damaging Het
Lrrc4b T C 7: 44,461,109 L135P probably damaging Het
Lrrk1 A G 7: 66,262,623 Y1730H possibly damaging Het
Mcpt2 C A 14: 56,042,206 A18D probably damaging Het
Mtmr4 C T 11: 87,611,930 R937* probably null Het
Muc16 T A 9: 18,658,737 T829S unknown Het
Mum1 G A 10: 80,240,397 G474S probably damaging Het
Myof A C 19: 37,932,719 I1365S probably damaging Het
Npc2 C T 12: 84,760,838 R82Q probably benign Het
Olfr1123 T A 2: 87,418,737 S228T probably damaging Het
Olfr1295 T C 2: 111,565,438 D2G probably benign Het
Olfr418 T A 1: 173,270,480 F102I possibly damaging Het
Olfr918 A T 9: 38,673,168 I92N possibly damaging Het
Olfr926 T A 9: 38,877,730 S185T probably damaging Het
Olfr934 A T 9: 38,982,873 M57K probably damaging Het
Pdzph1 T C 17: 58,975,143 N48S probably benign Het
Plce1 A T 19: 38,524,818 H187L probably benign Het
Pramel6 G T 2: 87,508,464 V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,797,574 probably null Het
Rabgap1l A G 1: 160,702,442 Y358H probably benign Het
Rbbp8 T C 18: 11,722,670 S625P probably damaging Het
Rhot1 A T 11: 80,251,053 K461I probably benign Het
Rpa1 G A 11: 75,302,675 T610I possibly damaging Het
Ryr1 G T 7: 29,110,883 H316N probably benign Het
Shprh T C 10: 11,213,461 S1648P probably damaging Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Spata6 A G 4: 111,828,320 Y474C possibly damaging Het
Sptbn1 A T 11: 30,139,117 I715N probably damaging Het
Stab1 A T 14: 31,158,953 D627E possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tfpi2 T C 6: 3,963,872 T187A probably damaging Het
Tmem63a G T 1: 180,960,483 K267N probably benign Het
Topaz1 C T 9: 122,775,643 A1104V probably benign Het
Trmt11 A G 10: 30,566,494 I231T possibly damaging Het
Utp15 G A 13: 98,250,863 T401I probably benign Het
Vmn2r13 T C 5: 109,175,060 K121R probably benign Het
Xab2 C T 8: 3,613,830 R363H probably damaging Het
Zfand2b T A 1: 75,168,860 F3L possibly damaging Het
Zfyve28 A T 5: 34,217,600 S357T probably damaging Het
Other mutations in Olfr117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr117 APN 17 37659477 missense probably damaging 1.00
IGL01949:Olfr117 APN 17 37659466 missense probably damaging 1.00
IGL02085:Olfr117 APN 17 37659688 missense probably benign 0.11
IGL02481:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL02483:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL03274:Olfr117 APN 17 37659755 missense probably benign 0.35
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R1522:Olfr117 UTSW 17 37659770 missense probably damaging 1.00
R1712:Olfr117 UTSW 17 37659908 missense probably benign 0.42
R1750:Olfr117 UTSW 17 37659673 missense probably damaging 1.00
R1865:Olfr117 UTSW 17 37659863 missense possibly damaging 0.78
R2371:Olfr117 UTSW 17 37660153 missense probably damaging 1.00
R2382:Olfr117 UTSW 17 37659931 missense probably benign 0.00
R3798:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R4831:Olfr117 UTSW 17 37660078 missense probably benign 0.03
R5087:Olfr117 UTSW 17 37659721 missense probably damaging 0.97
R5365:Olfr117 UTSW 17 37659695 missense probably damaging 1.00
R5812:Olfr117 UTSW 17 37659739 missense probably damaging 1.00
R5822:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R6405:Olfr117 UTSW 17 37660123 missense possibly damaging 0.58
R6945:Olfr117 UTSW 17 37659514 missense possibly damaging 0.95
R7121:Olfr117 UTSW 17 37659808 missense probably damaging 0.98
R7312:Olfr117 UTSW 17 37659512 missense possibly damaging 0.78
R7502:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R8425:Olfr117 UTSW 17 37660084 missense probably damaging 1.00
RF017:Olfr117 UTSW 17 37659781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTCCCTGACTCTGTGCATAG -3'
(R):5'- TCTGCCAATCTCTTGCAGGAG -3'

Sequencing Primer
(F):5'- ATATAGACAGCAGTGCTTGTGCC -3'
(R):5'- CAATCTCTTGCAGGAGTGGCG -3'
Posted On2020-06-30