Incidental Mutation 'R8116:Dsc2'
ID631236
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
MMRRC Submission
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8116 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20032274 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,091,594 N7K probably benign Het
Akap9 T A 5: 4,061,183 D3081E probably benign Het
Amer2 G A 14: 60,379,405 A350T probably damaging Het
Amotl1 A G 9: 14,555,572 probably null Het
Ankib1 A T 5: 3,702,995 V651E probably damaging Het
Aox1 T C 1: 58,076,124 V756A probably damaging Het
Arap2 A C 5: 62,730,611 I464S probably benign Het
Atp8a2 A C 14: 60,026,208 M359R probably damaging Het
Aunip T C 4: 134,523,307 S188P possibly damaging Het
Cdt1 A G 8: 122,571,989 E455G probably benign Het
Cyp2r1 G T 7: 114,550,355 H475N probably benign Het
Dnah7a G T 1: 53,503,890 H2374N probably benign Het
Dst G A 1: 34,274,180 A4343T probably benign Het
Efcab3 A G 11: 105,111,851 D304G possibly damaging Het
Efcc1 T C 6: 87,751,790 L409P probably damaging Het
Eno1 G T 4: 150,241,069 S37I probably damaging Het
Ermp1 A T 19: 29,623,796 L517Q probably damaging Het
Farp1 T G 14: 121,233,820 I196S probably damaging Het
Fbxo21 A G 5: 117,990,854 T310A possibly damaging Het
Fbxo31 C T 8: 121,560,388 V149M probably damaging Het
Ggcx C A 6: 72,429,528 T658N possibly damaging Het
Gm884 A T 11: 103,543,289 M3018K unknown Het
Gpc5 A C 14: 115,399,225 H440P probably damaging Het
H13 C T 2: 152,695,526 A297V probably damaging Het
H2-DMb1 T A 17: 34,155,469 L31Q probably damaging Het
Ifi207 G A 1: 173,730,180 P331S unknown Het
Il11ra1 G T 4: 41,766,251 A263S probably benign Het
Il1a C A 2: 129,302,944 V185F probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kdm4d T A 9: 14,463,941 K207M probably damaging Het
Lrrc4b T C 7: 44,461,109 L135P probably damaging Het
Lrrk1 A G 7: 66,262,623 Y1730H possibly damaging Het
Mcpt2 C A 14: 56,042,206 A18D probably damaging Het
Mtmr4 C T 11: 87,611,930 R937* probably null Het
Muc16 T A 9: 18,658,737 T829S unknown Het
Mum1 G A 10: 80,240,397 G474S probably damaging Het
Myof A C 19: 37,932,719 I1365S probably damaging Het
Npc2 C T 12: 84,760,838 R82Q probably benign Het
Olfr1123 T A 2: 87,418,737 S228T probably damaging Het
Olfr117 G A 17: 37,659,740 L198F probably damaging Het
Olfr1295 T C 2: 111,565,438 D2G probably benign Het
Olfr418 T A 1: 173,270,480 F102I possibly damaging Het
Olfr918 A T 9: 38,673,168 I92N possibly damaging Het
Olfr926 T A 9: 38,877,730 S185T probably damaging Het
Olfr934 A T 9: 38,982,873 M57K probably damaging Het
Pdzph1 T C 17: 58,975,143 N48S probably benign Het
Plce1 A T 19: 38,524,818 H187L probably benign Het
Pramel6 G T 2: 87,508,464 V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,797,574 probably null Het
Rabgap1l A G 1: 160,702,442 Y358H probably benign Het
Rbbp8 T C 18: 11,722,670 S625P probably damaging Het
Rhot1 A T 11: 80,251,053 K461I probably benign Het
Rpa1 G A 11: 75,302,675 T610I possibly damaging Het
Ryr1 G T 7: 29,110,883 H316N probably benign Het
Shprh T C 10: 11,213,461 S1648P probably damaging Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Spata6 A G 4: 111,828,320 Y474C possibly damaging Het
Sptbn1 A T 11: 30,139,117 I715N probably damaging Het
Stab1 A T 14: 31,158,953 D627E possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tfpi2 T C 6: 3,963,872 T187A probably damaging Het
Tmem63a G T 1: 180,960,483 K267N probably benign Het
Topaz1 C T 9: 122,775,643 A1104V probably benign Het
Trmt11 A G 10: 30,566,494 I231T possibly damaging Het
Utp15 G A 13: 98,250,863 T401I probably benign Het
Vmn2r13 T C 5: 109,175,060 K121R probably benign Het
Xab2 C T 8: 3,613,830 R363H probably damaging Het
Zfand2b T A 1: 75,168,860 F3L possibly damaging Het
Zfyve28 A T 5: 34,217,600 S357T probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On2020-06-30