Incidental Mutation 'R8116:Dsc2'
ID 631236
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 067545-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8116 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20165331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,982,420 (GRCm39) N7K probably benign Het
Akap9 T A 5: 4,111,183 (GRCm39) D3081E probably benign Het
Amer2 G A 14: 60,616,854 (GRCm39) A350T probably damaging Het
Amotl1 A G 9: 14,466,868 (GRCm39) probably null Het
Ankib1 A T 5: 3,752,995 (GRCm39) V651E probably damaging Het
Aox1 T C 1: 58,115,283 (GRCm39) V756A probably damaging Het
Arap2 A C 5: 62,887,954 (GRCm39) I464S probably benign Het
Atp8a2 A C 14: 60,263,657 (GRCm39) M359R probably damaging Het
Aunip T C 4: 134,250,618 (GRCm39) S188P possibly damaging Het
Cdt1 A G 8: 123,298,728 (GRCm39) E455G probably benign Het
Cyp2r1 G T 7: 114,149,590 (GRCm39) H475N probably benign Het
Dnah7a G T 1: 53,543,049 (GRCm39) H2374N probably benign Het
Dst G A 1: 34,313,261 (GRCm39) A4343T probably benign Het
Efcab3 A G 11: 105,002,677 (GRCm39) D304G possibly damaging Het
Efcc1 T C 6: 87,728,772 (GRCm39) L409P probably damaging Het
Eno1 G T 4: 150,325,526 (GRCm39) S37I probably damaging Het
Ermp1 A T 19: 29,601,196 (GRCm39) L517Q probably damaging Het
Farp1 T G 14: 121,471,232 (GRCm39) I196S probably damaging Het
Fbxo21 A G 5: 118,128,919 (GRCm39) T310A possibly damaging Het
Fbxo31 C T 8: 122,287,127 (GRCm39) V149M probably damaging Het
Ggcx C A 6: 72,406,511 (GRCm39) T658N possibly damaging Het
Gpc5 A C 14: 115,636,637 (GRCm39) H440P probably damaging Het
H13 C T 2: 152,537,446 (GRCm39) A297V probably damaging Het
H2-DMb1 T A 17: 34,374,443 (GRCm39) L31Q probably damaging Het
Ifi207 G A 1: 173,557,746 (GRCm39) P331S unknown Het
Il11ra1 G T 4: 41,766,251 (GRCm39) A263S probably benign Het
Il1a C A 2: 129,144,864 (GRCm39) V185F probably damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Kdm4d T A 9: 14,375,237 (GRCm39) K207M probably damaging Het
Lrrc37 A T 11: 103,434,115 (GRCm39) M3018K unknown Het
Lrrc4b T C 7: 44,110,533 (GRCm39) L135P probably damaging Het
Lrrk1 A G 7: 65,912,371 (GRCm39) Y1730H possibly damaging Het
Mcpt2 C A 14: 56,279,663 (GRCm39) A18D probably damaging Het
Mtmr4 C T 11: 87,502,756 (GRCm39) R937* probably null Het
Muc16 T A 9: 18,570,033 (GRCm39) T829S unknown Het
Myof A C 19: 37,921,167 (GRCm39) I1365S probably damaging Het
Npc2 C T 12: 84,807,612 (GRCm39) R82Q probably benign Het
Or10ag2 T A 2: 87,249,081 (GRCm39) S228T probably damaging Het
Or10d1c A T 9: 38,894,169 (GRCm39) M57K probably damaging Het
Or10j2 T A 1: 173,098,047 (GRCm39) F102I possibly damaging Het
Or2g25 G A 17: 37,970,631 (GRCm39) L198F probably damaging Het
Or4k45 T C 2: 111,395,783 (GRCm39) D2G probably benign Het
Or8b3b A T 9: 38,584,464 (GRCm39) I92N possibly damaging Het
Or8d2b T A 9: 38,789,026 (GRCm39) S185T probably damaging Het
Pdzph1 T C 17: 59,282,138 (GRCm39) N48S probably benign Het
Plce1 A T 19: 38,513,262 (GRCm39) H187L probably benign Het
Pramel6 G T 2: 87,338,808 (GRCm39) V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,627,919 (GRCm39) probably null Het
Pwwp3a G A 10: 80,076,231 (GRCm39) G474S probably damaging Het
Rabgap1l A G 1: 160,530,012 (GRCm39) Y358H probably benign Het
Rbbp8 T C 18: 11,855,727 (GRCm39) S625P probably damaging Het
Rhot1 A T 11: 80,141,879 (GRCm39) K461I probably benign Het
Rpa1 G A 11: 75,193,501 (GRCm39) T610I possibly damaging Het
Ryr1 G T 7: 28,810,308 (GRCm39) H316N probably benign Het
Shprh T C 10: 11,089,205 (GRCm39) S1648P probably damaging Het
Sipa1 A T 19: 5,702,140 (GRCm39) D923E possibly damaging Het
Spata6 A G 4: 111,685,517 (GRCm39) Y474C possibly damaging Het
Sptbn1 A T 11: 30,089,117 (GRCm39) I715N probably damaging Het
Stab1 A T 14: 30,880,910 (GRCm39) D627E possibly damaging Het
Stard9 T A 2: 120,495,420 (GRCm39) C98* probably null Het
Tfpi2 T C 6: 3,963,872 (GRCm39) T187A probably damaging Het
Tmem63a G T 1: 180,788,048 (GRCm39) K267N probably benign Het
Topaz1 C T 9: 122,604,708 (GRCm39) A1104V probably benign Het
Trmt11 A G 10: 30,442,490 (GRCm39) I231T possibly damaging Het
Utp15 G A 13: 98,387,371 (GRCm39) T401I probably benign Het
Vmn2r13 T C 5: 109,322,926 (GRCm39) K121R probably benign Het
Xab2 C T 8: 3,663,830 (GRCm39) R363H probably damaging Het
Zfand2b T A 1: 75,145,504 (GRCm39) F3L possibly damaging Het
Zfyve28 A T 5: 34,374,944 (GRCm39) S357T probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On 2020-06-30