Incidental Mutation 'R8117:Cc2d2a'
ID 631263
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 067546-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R8117 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43869781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 943 (F943S)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: F943S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: F943S

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: F894S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: F894S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,058,078 (GRCm39) T14A Het
2610008E11Rik T C 10: 78,930,289 (GRCm39) N42D probably benign Het
Ajm1 A G 2: 25,469,246 (GRCm39) F222L probably benign Het
Ankrd54 T A 15: 78,939,641 (GRCm39) M183L Het
Apob G A 12: 8,056,435 (GRCm39) G1639D probably damaging Het
B3gat2 A G 1: 23,884,061 (GRCm39) T283A probably benign Het
Bmpr2 T G 1: 59,886,252 (GRCm39) S296R probably damaging Het
Cand1 G A 10: 119,042,721 (GRCm39) T1123I probably damaging Het
Ccdc40 T C 11: 119,144,211 (GRCm39) I912T probably benign Het
Cdkn2d G A 9: 21,200,447 (GRCm39) S108L probably benign Het
Cep295 G A 9: 15,245,660 (GRCm39) T932I probably damaging Het
Cntn5 A G 9: 9,673,955 (GRCm39) S716P probably benign Het
Col18a1 T C 10: 76,895,808 (GRCm39) E903G probably benign Het
Ctrc T A 4: 141,565,972 (GRCm39) I229F probably damaging Het
Cyb561d2 C T 9: 107,418,771 (GRCm39) A18T probably benign Het
Dnajb4 T A 3: 151,899,089 (GRCm39) K46* probably null Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Dsg1c C T 18: 20,410,016 (GRCm39) H495Y probably benign Het
Eif2b3 A G 4: 116,879,414 (GRCm39) D18G probably damaging Het
Enam A T 5: 88,651,385 (GRCm39) I965L probably benign Het
Fhod3 T A 18: 25,248,910 (GRCm39) I1363K probably damaging Het
Fras1 A G 5: 96,855,245 (GRCm39) Y1918C probably damaging Het
Fsip2 T A 2: 82,823,296 (GRCm39) I6343N possibly damaging Het
Gpr45 G C 1: 43,072,475 (GRCm39) V373L probably damaging Het
Hdac2 G T 10: 36,873,966 (GRCm39) Q365H probably damaging Het
Hspa12b A G 2: 130,980,389 (GRCm39) T103A possibly damaging Het
Ifrd1 A T 12: 40,262,350 (GRCm39) S287T probably benign Het
Igkv6-15 G A 6: 70,383,622 (GRCm39) P60S possibly damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Kctd19 T A 8: 106,122,069 (GRCm39) D109V unknown Het
Matn4 G A 2: 164,234,851 (GRCm39) S540L probably damaging Het
Matn4 T C 2: 164,241,682 (GRCm39) K248E probably benign Het
Muc16 G A 9: 18,420,206 (GRCm39) Q97* probably null Het
Mup18 A G 4: 61,592,238 (GRCm39) C9R unknown Het
Myh1 A G 11: 67,113,031 (GRCm39) K1845R probably damaging Het
Mysm1 G A 4: 94,848,627 (GRCm39) R469* probably null Het
Naip1 T C 13: 100,563,509 (GRCm39) D552G possibly damaging Het
Nrcam A G 12: 44,618,371 (GRCm39) D787G probably benign Het
Nrcam G A 12: 44,645,365 (GRCm39) V1256I probably damaging Het
Obscn G T 11: 58,932,980 (GRCm39) H4799N possibly damaging Het
Or1f12 T C 13: 21,722,122 (GRCm39) K3E probably benign Het
Or4p4 A G 2: 88,482,729 (GRCm39) K78E probably damaging Het
Or52e18 T C 7: 104,609,356 (GRCm39) I194M probably damaging Het
Or7g22 A G 9: 19,048,353 (GRCm39) I21M probably benign Het
Pcdhgb5 T C 18: 37,866,302 (GRCm39) F699S probably damaging Het
Phtf2 T C 5: 21,007,038 (GRCm39) E175G probably benign Het
Pira1 G A 7: 3,740,075 (GRCm39) T340I probably damaging Het
Ppp2r5c A G 12: 110,517,519 (GRCm39) H218R possibly damaging Het
Ptgs2 A G 1: 149,979,785 (GRCm39) R297G probably damaging Het
Rapgef3 A T 15: 97,648,747 (GRCm39) D619E probably benign Het
Ric1 G A 19: 29,552,191 (GRCm39) V321I probably benign Het
Ripor1 T C 8: 106,344,105 (GRCm39) V413A probably damaging Het
Rsf1 G T 7: 97,288,464 (GRCm39) probably null Het
Sccpdh A G 1: 179,504,017 (GRCm39) D122G probably damaging Het
Sec16a A T 2: 26,331,441 (GRCm39) H191Q probably benign Het
Slco1a5 G T 6: 142,208,418 (GRCm39) N124K probably damaging Het
Snrnp200 A G 2: 127,071,051 (GRCm39) T1111A probably benign Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Tanc2 T A 11: 105,725,988 (GRCm39) V384E probably damaging Het
Tbrg1 A G 9: 37,568,296 (GRCm39) F49L possibly damaging Het
Tecta A G 9: 42,288,927 (GRCm39) F546S probably damaging Het
Tmem132c A G 5: 127,437,176 (GRCm39) R222G probably benign Het
Trub2 C T 2: 29,668,739 (GRCm39) probably null Het
Tti1 G T 2: 157,849,418 (GRCm39) P607Q probably damaging Het
Vmn1r62 T A 7: 5,678,726 (GRCm39) F136I possibly damaging Het
Vmn2r111 T A 17: 22,790,469 (GRCm39) H179L probably benign Het
Wdfy4 A T 14: 32,699,063 (GRCm39) C2703* probably null Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wipf3 A G 6: 54,460,816 (GRCm39) K88R probably benign Het
Zfp641 C T 15: 98,186,856 (GRCm39) G256R probably damaging Het
Zfp993 T A 4: 146,741,972 (GRCm39) C99S probably benign Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTGTGTCTTCTTGCTC -3'
(R):5'- CTGGAGAGTCCTTAGCACAGAC -3'

Sequencing Primer
(F):5'- ACCAGTGGTGAATCCTATGTC -3'
(R):5'- GACTTGCTATACTCAAATGGCGTCG -3'
Posted On 2020-06-30