Mutagenetix > Incidental Mutation

Incidental Mutation 'R8117:Olfr670'

631272

Institutional Source

Beutler Lab

Gene Symbol

Olfr670

Ensembl Gene

ENSMUSG00000044705

Gene Name

olfactory receptor 670

Synonyms

MOR32-8, GA_x6K02T2PBJ9-7589577-7588639

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R8117 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104957114-104962620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104960149 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 194 (I194M)

Ref Sequence

ENSEMBL: ENSMUSP00000151138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]

AlphaFold

Q7TRP3

Predicted Effect

probably damaging
Transcript: ENSMUST00000050482
AA Change: I194M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: I194M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	311	3.7e-121	PFAM
Pfam:7TM_GPCR_Srsx	37	211	4.5e-7	PFAM
Pfam:7tm_1	43	293	3.9e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214216
AA Change: I194M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.5%
20x: 94.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,448	T14A		Het
2610008E11Rik	T	C	10: 79,094,455	N42D	probably benign	Het
Ankrd54	T	A	15: 79,055,441	M183L		Het
Apob	G	A	12: 8,006,435	G1639D	probably damaging	Het
B3gat2	A	G	1: 23,844,980	T283A	probably benign	Het
Bmpr2	T	G	1: 59,847,093	S296R	probably damaging	Het
Cand1	G	A	10: 119,206,816	T1123I	probably damaging	Het
Cc2d2a	T	C	5: 43,712,439	F943S	probably damaging	Het
Ccdc40	T	C	11: 119,253,385	I912T	probably benign	Het
Cdkn2d	G	A	9: 21,289,151	S108L	probably benign	Het
Cep295	G	A	9: 15,334,364	T932I	probably damaging	Het
Cntn5	A	G	9: 9,673,950	S716P	probably benign	Het
Col18a1	T	C	10: 77,059,974	E903G	probably benign	Het
Ctrc	T	A	4: 141,838,661	I229F	probably damaging	Het
Cyb561d2	C	T	9: 107,541,572	A18T	probably benign	Het
Dnajb4	T	A	3: 152,193,452	K46*	probably null	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Dsg1c	C	T	18: 20,276,959	H495Y	probably benign	Het
Eif2b3	A	G	4: 117,022,217	D18G	probably damaging	Het
Enam	A	T	5: 88,503,526	I965L	probably benign	Het
Fhod3	T	A	18: 25,115,853	I1363K	probably damaging	Het
Fras1	A	G	5: 96,707,386	Y1918C	probably damaging	Het
Fsip2	T	A	2: 82,992,952	I6343N	possibly damaging	Het
Gm15922	G	A	7: 3,737,076	T340I	probably damaging	Het
Gm996	A	G	2: 25,579,234	F222L	probably benign	Het
Gpr45	G	C	1: 43,033,315	V373L	probably damaging	Het
Hdac2	G	T	10: 36,997,970	Q365H	probably damaging	Het
Hspa12b	A	G	2: 131,138,469	T103A	possibly damaging	Het
Ifrd1	A	T	12: 40,212,351	S287T	probably benign	Het
Igkv6-15	G	A	6: 70,406,638	P60S	possibly damaging	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Kctd19	T	A	8: 105,395,437	D109V	unknown	Het
Matn4	G	A	2: 164,392,931	S540L	probably damaging	Het
Matn4	T	C	2: 164,399,762	K248E	probably benign	Het
Muc16	G	A	9: 18,508,910	Q97*	probably null	Het
Mup18	A	G	4: 61,674,001	C9R	unknown	Het
Myh1	A	G	11: 67,222,205	K1845R	probably damaging	Het
Mysm1	G	A	4: 94,960,390	R469*	probably null	Het
Naip1	T	C	13: 100,427,001	D552G	possibly damaging	Het
Nrcam	A	G	12: 44,571,588	D787G	probably benign	Het
Nrcam	G	A	12: 44,598,582	V1256I	probably damaging	Het
Obscn	G	T	11: 59,042,154	H4799N	possibly damaging	Het
Olfr1192-ps1	A	G	2: 88,652,385	K78E	probably damaging	Het
Olfr1366	T	C	13: 21,537,952	K3E	probably benign	Het
Olfr837	A	G	9: 19,137,057	I21M	probably benign	Het
Pcdhgb5	T	C	18: 37,733,249	F699S	probably damaging	Het
Phtf2	T	C	5: 20,802,040	E175G	probably benign	Het
Ppp2r5c	A	G	12: 110,551,085	H218R	possibly damaging	Het
Ptgs2	A	G	1: 150,104,034	R297G	probably damaging	Het
Rapgef3	A	T	15: 97,750,866	D619E	probably benign	Het
Ric1	G	A	19: 29,574,791	V321I	probably benign	Het
Ripor1	T	C	8: 105,617,473	V413A	probably damaging	Het
Rsf1	G	T	7: 97,639,257		probably null	Het
Sccpdh	A	G	1: 179,676,452	D122G	probably damaging	Het
Sec16a	A	T	2: 26,441,429	H191Q	probably benign	Het
Slco1a5	G	T	6: 142,262,692	N124K	probably damaging	Het
Snrnp200	A	G	2: 127,229,131	T1111A	probably benign	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Tanc2	T	A	11: 105,835,162	V384E	probably damaging	Het
Tbrg1	A	G	9: 37,657,000	F49L	possibly damaging	Het
Tecta	A	G	9: 42,377,631	F546S	probably damaging	Het
Tmem132c	A	G	5: 127,360,112	R222G	probably benign	Het
Trub2	C	T	2: 29,778,727		probably null	Het
Tti1	G	T	2: 158,007,498	P607Q	probably damaging	Het
Vmn1r62	T	A	7: 5,675,727	F136I	possibly damaging	Het
Vmn2r111	T	A	17: 22,571,488	H179L	probably benign	Het
Wdfy4	A	T	14: 32,977,106	C2703*	probably null	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Wipf3	A	G	6: 54,483,831	K88R	probably benign	Het
Zfp641	C	T	15: 98,288,975	G256R	probably damaging	Het
Zfp993	T	A	4: 146,657,515	C99S	probably benign	Het

Other mutations in Olfr670

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Olfr670	APN	7	104960716	missense	probably damaging	0.96
IGL01100:Olfr670	APN	7	104959995	missense	probably benign	0.07
IGL01351:Olfr670	APN	7	104960739	start gained	probably benign
IGL01478:Olfr670	APN	7	104960348	missense	probably damaging	0.97
IGL01835:Olfr670	APN	7	104960462	missense	probably benign	0.01
IGL02326:Olfr670	APN	7	104960646	missense	probably benign	0.12
IGL02434:Olfr670	APN	7	104960072	missense	probably benign	0.05
IGL02434:Olfr670	APN	7	104960074	nonsense	probably null
IGL02968:Olfr670	APN	7	104960244	missense	possibly damaging	0.90
R0055:Olfr670	UTSW	7	104960496	missense	possibly damaging	0.46
R0055:Olfr670	UTSW	7	104960496	missense	possibly damaging	0.46
R0345:Olfr670	UTSW	7	104960181	missense	probably damaging	1.00
R0401:Olfr670	UTSW	7	104959943	missense	probably damaging	1.00
R0646:Olfr670	UTSW	7	104959811	missense	probably benign	0.02
R1493:Olfr670	UTSW	7	104960502	missense	probably damaging	0.97
R1532:Olfr670	UTSW	7	104960265	missense	probably benign
R1557:Olfr670	UTSW	7	104960540	missense	probably damaging	0.99
R4072:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4074:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4075:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4076:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4229:Olfr670	UTSW	7	104960594	missense	probably benign	0.18
R4230:Olfr670	UTSW	7	104960594	missense	probably benign	0.18
R5374:Olfr670	UTSW	7	104959996	missense	probably damaging	1.00
R6006:Olfr670	UTSW	7	104960663	missense	probably damaging	0.99
R6891:Olfr670	UTSW	7	104959985	missense	probably damaging	1.00
R7465:Olfr670	UTSW	7	104959917	missense	probably benign	0.23
R8105:Olfr670	UTSW	7	104960422	missense	probably benign	0.15
R8356:Olfr670	UTSW	7	104960727	missense	probably benign	0.00
R8510:Olfr670	UTSW	7	104960114	nonsense	probably null
R9145:Olfr670	UTSW	7	104959997	missense	probably damaging	1.00
R9168:Olfr670	UTSW	7	104959794	makesense	probably null
R9234:Olfr670	UTSW	7	104960444	missense	probably damaging	1.00
R9706:Olfr670	UTSW	7	104959988	missense	probably damaging	0.99
R9789:Olfr670	UTSW	7	104960450	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCTGCCAAACCTATGTGTC -3'
(R):5'- GCGGTACAGTCAGATTCTCAC -3'

Sequencing Primer
(F):5'- CCTGCCAAACCTATGTGTCATGAATG -3'
(R):5'- GGTACAGTCAGATTCTCACCAACAG -3'

Posted On

2020-06-30