Mutagenetix > Incidental Mutation

Incidental Mutation 'R8117:Ripor1'

631273

Institutional Source

Beutler Lab

Gene Symbol

Ripor1

Ensembl Gene

ENSMUSG00000038604

Gene Name

RHO family interacting cell polarization regulator 1

Synonyms

Fam65a, 2310066E14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.504) question?

Stock #

R8117 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105605255-105622219 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105617473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 413 (V413A)

Ref Sequence

ENSEMBL: ENSMUSP00000039966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043531] [ENSMUST00000194091]

AlphaFold

Q68FE6

Predicted Effect

probably damaging
Transcript: ENSMUST00000043531
AA Change: V413A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000039966
Gene: ENSMUSG00000038604
AA Change: V413A

Domain	Start	End	E-Value	Type
Pfam:PL48	17	365	1.7e-170	PFAM
low complexity region	376	391	N/A	INTRINSIC
low complexity region	399	413	N/A	INTRINSIC
low complexity region	564	586	N/A	INTRINSIC
low complexity region	595	655	N/A	INTRINSIC
low complexity region	673	688	N/A	INTRINSIC
low complexity region	748	771	N/A	INTRINSIC
low complexity region	858	870	N/A	INTRINSIC
Pfam:HEAT_2	1135	1209	3.9e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000194091

SMART Domains

Protein: ENSMUSP00000142044
Gene: ENSMUSG00000005705

Domain	Start	End	E-Value	Type
Agouti	1	121	2.01e-56	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.5%
20x: 94.4%

Validation Efficiency

99% (73/74)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,448	T14A		Het
2610008E11Rik	T	C	10: 79,094,455	N42D	probably benign	Het
Ankrd54	T	A	15: 79,055,441	M183L		Het
Apob	G	A	12: 8,006,435	G1639D	probably damaging	Het
B3gat2	A	G	1: 23,844,980	T283A	probably benign	Het
Bmpr2	T	G	1: 59,847,093	S296R	probably damaging	Het
Cand1	G	A	10: 119,206,816	T1123I	probably damaging	Het
Cc2d2a	T	C	5: 43,712,439	F943S	probably damaging	Het
Ccdc40	T	C	11: 119,253,385	I912T	probably benign	Het
Cdkn2d	G	A	9: 21,289,151	S108L	probably benign	Het
Cep295	G	A	9: 15,334,364	T932I	probably damaging	Het
Cntn5	A	G	9: 9,673,950	S716P	probably benign	Het
Col18a1	T	C	10: 77,059,974	E903G	probably benign	Het
Ctrc	T	A	4: 141,838,661	I229F	probably damaging	Het
Cyb561d2	C	T	9: 107,541,572	A18T	probably benign	Het
Dnajb4	T	A	3: 152,193,452	K46*	probably null	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Dsg1c	C	T	18: 20,276,959	H495Y	probably benign	Het
Eif2b3	A	G	4: 117,022,217	D18G	probably damaging	Het
Enam	A	T	5: 88,503,526	I965L	probably benign	Het
Fhod3	T	A	18: 25,115,853	I1363K	probably damaging	Het
Fras1	A	G	5: 96,707,386	Y1918C	probably damaging	Het
Fsip2	T	A	2: 82,992,952	I6343N	possibly damaging	Het
Gm15922	G	A	7: 3,737,076	T340I	probably damaging	Het
Gm996	A	G	2: 25,579,234	F222L	probably benign	Het
Gpr45	G	C	1: 43,033,315	V373L	probably damaging	Het
Hdac2	G	T	10: 36,997,970	Q365H	probably damaging	Het
Hspa12b	A	G	2: 131,138,469	T103A	possibly damaging	Het
Ifrd1	A	T	12: 40,212,351	S287T	probably benign	Het
Igkv6-15	G	A	6: 70,406,638	P60S	possibly damaging	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Kctd19	T	A	8: 105,395,437	D109V	unknown	Het
Matn4	T	C	2: 164,399,762	K248E	probably benign	Het
Matn4	G	A	2: 164,392,931	S540L	probably damaging	Het
Muc16	G	A	9: 18,508,910	Q97*	probably null	Het
Mup18	A	G	4: 61,674,001	C9R	unknown	Het
Myh1	A	G	11: 67,222,205	K1845R	probably damaging	Het
Mysm1	G	A	4: 94,960,390	R469*	probably null	Het
Naip1	T	C	13: 100,427,001	D552G	possibly damaging	Het
Nrcam	A	G	12: 44,571,588	D787G	probably benign	Het
Nrcam	G	A	12: 44,598,582	V1256I	probably damaging	Het
Obscn	G	T	11: 59,042,154	H4799N	possibly damaging	Het
Olfr1192-ps1	A	G	2: 88,652,385	K78E	probably damaging	Het
Olfr1366	T	C	13: 21,537,952	K3E	probably benign	Het
Olfr670	T	C	7: 104,960,149	I194M	probably damaging	Het
Olfr837	A	G	9: 19,137,057	I21M	probably benign	Het
Pcdhgb5	T	C	18: 37,733,249	F699S	probably damaging	Het
Phtf2	T	C	5: 20,802,040	E175G	probably benign	Het
Ppp2r5c	A	G	12: 110,551,085	H218R	possibly damaging	Het
Ptgs2	A	G	1: 150,104,034	R297G	probably damaging	Het
Rapgef3	A	T	15: 97,750,866	D619E	probably benign	Het
Ric1	G	A	19: 29,574,791	V321I	probably benign	Het
Rsf1	G	T	7: 97,639,257		probably null	Het
Sccpdh	A	G	1: 179,676,452	D122G	probably damaging	Het
Sec16a	A	T	2: 26,441,429	H191Q	probably benign	Het
Slco1a5	G	T	6: 142,262,692	N124K	probably damaging	Het
Snrnp200	A	G	2: 127,229,131	T1111A	probably benign	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Tanc2	T	A	11: 105,835,162	V384E	probably damaging	Het
Tbrg1	A	G	9: 37,657,000	F49L	possibly damaging	Het
Tecta	A	G	9: 42,377,631	F546S	probably damaging	Het
Tmem132c	A	G	5: 127,360,112	R222G	probably benign	Het
Trub2	C	T	2: 29,778,727		probably null	Het
Tti1	G	T	2: 158,007,498	P607Q	probably damaging	Het
Vmn1r62	T	A	7: 5,675,727	F136I	possibly damaging	Het
Vmn2r111	T	A	17: 22,571,488	H179L	probably benign	Het
Wdfy4	A	T	14: 32,977,106	C2703*	probably null	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Wipf3	A	G	6: 54,483,831	K88R	probably benign	Het
Zfp641	C	T	15: 98,288,975	G256R	probably damaging	Het
Zfp993	T	A	4: 146,657,515	C99S	probably benign	Het

Other mutations in Ripor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Ripor1	APN	8	105621433	intron	probably benign
IGL00658:Ripor1	APN	8	105618117	intron	probably benign
IGL01511:Ripor1	APN	8	105619930	intron	probably benign
IGL01733:Ripor1	APN	8	105615746	missense	possibly damaging	0.63
IGL02805:Ripor1	APN	8	105617571	missense	probably damaging	0.99
IGL03049:Ripor1	APN	8	105615447	missense	probably damaging	0.96
IGL03246:Ripor1	APN	8	105615858	missense	possibly damaging	0.92
dank	UTSW	8	105618114	intron	probably benign
Regenerative	UTSW	8	105621431	missense	unknown
riparian	UTSW	8	105617785	missense	possibly damaging	0.94
R0650:Ripor1	UTSW	8	105618114	intron	probably benign
R1109:Ripor1	UTSW	8	105618928	intron	probably benign
R1480:Ripor1	UTSW	8	105615548	missense	probably damaging	0.96
R1914:Ripor1	UTSW	8	105616886	missense	probably damaging	1.00
R1915:Ripor1	UTSW	8	105616886	missense	probably damaging	1.00
R2067:Ripor1	UTSW	8	105617708	missense	probably benign	0.05
R2111:Ripor1	UTSW	8	105614712	missense	probably damaging	1.00
R2513:Ripor1	UTSW	8	105617622	missense	probably benign	0.27
R4119:Ripor1	UTSW	8	105618857	intron	probably benign
R4120:Ripor1	UTSW	8	105618857	intron	probably benign
R4415:Ripor1	UTSW	8	105617976	missense	probably benign	0.10
R4668:Ripor1	UTSW	8	105614652	missense	probably benign	0.30
R4679:Ripor1	UTSW	8	105617785	missense	possibly damaging	0.94
R4777:Ripor1	UTSW	8	105614990	missense	probably damaging	1.00
R4930:Ripor1	UTSW	8	105617182	missense	probably damaging	1.00
R5004:Ripor1	UTSW	8	105618820	frame shift	probably null
R5569:Ripor1	UTSW	8	105617515	missense	probably damaging	0.98
R5868:Ripor1	UTSW	8	105616004	missense	probably damaging	1.00
R7187:Ripor1	UTSW	8	105617874	missense	probably benign	0.22
R7311:Ripor1	UTSW	8	105617815	nonsense	probably null
R8165:Ripor1	UTSW	8	105620888	missense	unknown
R9047:Ripor1	UTSW	8	105616151	missense	probably damaging	1.00
R9056:Ripor1	UTSW	8	105617440	missense	possibly damaging	0.67
R9172:Ripor1	UTSW	8	105621201	missense	unknown
R9246:Ripor1	UTSW	8	105618890	missense	unknown
R9267:Ripor1	UTSW	8	105621431	missense	unknown
R9798:Ripor1	UTSW	8	105616166	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TTGGTGTGACCCTGAAGTGC -3'
(R):5'- TCTGGATAGACAAGCGGGCTAG -3'

Sequencing Primer
(F):5'- AAGTGCACTTCTTTCTCTCTTAGAAC -3'
(R):5'- GGCTAGGCCCTGGGATTG -3'

Posted On

2020-06-30