Incidental Mutation 'R8117:Cntn5'
ID631274
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8117 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9673950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 716 (S716P)
Ref Sequence ENSEMBL: ENSMUSP00000124214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably benign
Transcript: ENSMUST00000074133
AA Change: S921P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: S921P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160216
AA Change: S921P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: S921P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162484
AA Change: S716P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: S716P

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179049
AA Change: S716P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: S716P

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Cyb561d2 C T 9: 107,541,572 A18T probably benign Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg1c C T 18: 20,276,959 H495Y probably benign Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kctd19 T A 8: 105,395,437 D109V unknown Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Rapgef3 A T 15: 97,750,866 D619E probably benign Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Vmn2r111 T A 17: 22,571,488 H179L probably benign Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9704929 missense probably benign 0.01
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R8159:Cntn5 UTSW 9 10145381 missense possibly damaging 0.91
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCCAGGTCACTTACGGTG -3'
(R):5'- GAAATCAAGGCAGTTTGGGC -3'

Sequencing Primer
(F):5'- AGGTCACTTACGGTGCCTCTTTG -3'
(R):5'- CAGAGGCAATTTCTTTCAGGG -3'
Posted On2020-06-30