Incidental Mutation 'R8117:Cyb561d2'
ID631281
Institutional Source Beutler Lab
Gene Symbol Cyb561d2
Ensembl Gene ENSMUSG00000037190
Gene Namecytochrome b-561 domain containing 2
SynonymsTsp10, 101F6 protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8117 (G1)
Quality Score177.009
Status Validated
Chromosome9
Chromosomal Location107539007-107542193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107541572 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 18 (A18T)
Ref Sequence ENSEMBL: ENSMUSP00000044093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000010201] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235] [ENSMUST00000195370]
Predicted Effect probably benign
Transcript: ENSMUST00000010189
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000010201
SMART Domains Protein: ENSMUSP00000010201
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 5 279 1.7e-75 PFAM
Pfam:NPR2 269 373 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041459
AA Change: A18T

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190
AA Change: A18T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect probably benign
Transcript: ENSMUST00000194967
AA Change: A18T

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000195235
AA Change: A18T

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190
AA Change: A18T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195370
SMART Domains Protein: ENSMUSP00000141746
Gene: ENSMUSG00000010057

DomainStartEndE-ValueType
Pfam:NPR2 2 156 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Cntn5 A G 9: 9,673,950 S716P probably benign Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg1c C T 18: 20,276,959 H495Y probably benign Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kctd19 T A 8: 105,395,437 D109V unknown Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Rapgef3 A T 15: 97,750,866 D619E probably benign Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Vmn2r111 T A 17: 22,571,488 H179L probably benign Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Cyb561d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Cyb561d2 APN 9 107540289 critical splice donor site probably null
IGL01890:Cyb561d2 APN 9 107541523 missense probably damaging 0.98
IGL02668:Cyb561d2 APN 9 107540172 missense probably benign 0.00
R1434:Cyb561d2 UTSW 9 107541643 unclassified probably benign
R1937:Cyb561d2 UTSW 9 107540316 missense probably damaging 1.00
R3416:Cyb561d2 UTSW 9 107540126 missense probably damaging 1.00
R4995:Cyb561d2 UTSW 9 107541548 missense probably damaging 1.00
R6538:Cyb561d2 UTSW 9 107540017 missense possibly damaging 0.86
R7564:Cyb561d2 UTSW 9 107541019 missense probably benign 0.02
R7719:Cyb561d2 UTSW 9 107540184 missense probably benign
Z1176:Cyb561d2 UTSW 9 107540296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGGAGTTACGCCCATC -3'
(R):5'- GTAGACTGCTAAGTTGGGACTG -3'

Sequencing Primer
(F):5'- GCCCATCGTTTCCTACTGC -3'
(R):5'- CTGTCATAACTTCTCCGGGAAAAGG -3'
Posted On2020-06-30