Incidental Mutation 'R8117:Rapgef3'
ID631302
Institutional Source Beutler Lab
Gene Symbol Rapgef3
Ensembl Gene ENSMUSG00000022469
Gene NameRap guanine nucleotide exchange factor (GEF) 3
Synonyms2310016P22Rik, 9330170P05Rik, Epac1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R8117 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location97744770-97767972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97750866 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 619 (D619E)
Ref Sequence ENSEMBL: ENSMUSP00000116426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134885] [ENSMUST00000175894] [ENSMUST00000177352]
Predicted Effect probably benign
Transcript: ENSMUST00000126854
AA Change: D619E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: D619E

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 926 7.98e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128775
AA Change: D619E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: D619E

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 7e-45 BLAST
RasGEF 661 909 5.53e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129223
AA Change: D619E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: D619E

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 918 2.11e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134885
SMART Domains Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
RasGEF 1 216 2.91e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175894
Predicted Effect probably benign
Transcript: ENSMUST00000177352
AA Change: D577E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469
AA Change: D577E

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
cNMP 203 322 2.53e-12 SMART
RasGEFN 341 472 7.04e-10 SMART
Blast:RasGEF 505 602 3e-45 BLAST
RasGEF 619 884 7.98e-95 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Cntn5 A G 9: 9,673,950 S716P probably benign Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Cyb561d2 C T 9: 107,541,572 A18T probably benign Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg1c C T 18: 20,276,959 H495Y probably benign Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kctd19 T A 8: 105,395,437 D109V unknown Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Vmn2r111 T A 17: 22,571,488 H179L probably benign Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Rapgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Rapgef3 APN 15 97748223 missense probably damaging 1.00
IGL01339:Rapgef3 APN 15 97758059 missense probably damaging 1.00
IGL01670:Rapgef3 APN 15 97749662 missense probably benign 0.15
IGL01902:Rapgef3 APN 15 97750300 missense probably benign 0.32
IGL02137:Rapgef3 APN 15 97750144 missense probably benign 0.08
IGL02419:Rapgef3 APN 15 97750290 missense probably benign 0.33
IGL02427:Rapgef3 APN 15 97747136 splice site probably null
IGL02648:Rapgef3 APN 15 97758392 missense probably damaging 1.00
IGL02834:Rapgef3 APN 15 97748265 missense probably damaging 0.98
IGL03389:Rapgef3 APN 15 97749516 missense probably damaging 1.00
IGL03055:Rapgef3 UTSW 15 97749489 splice site probably benign
R0394:Rapgef3 UTSW 15 97757819 intron probably benign
R0538:Rapgef3 UTSW 15 97757817 intron probably benign
R0744:Rapgef3 UTSW 15 97761585 splice site probably benign
R1288:Rapgef3 UTSW 15 97759342 missense probably benign 0.31
R1512:Rapgef3 UTSW 15 97757501 missense probably benign 0.24
R1676:Rapgef3 UTSW 15 97761182 missense probably benign 0.35
R1745:Rapgef3 UTSW 15 97750178 missense probably benign 0.22
R1928:Rapgef3 UTSW 15 97750033 missense probably damaging 1.00
R2063:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2067:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2092:Rapgef3 UTSW 15 97760723 missense probably damaging 1.00
R4358:Rapgef3 UTSW 15 97748648 missense probably benign 0.05
R4624:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4627:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4727:Rapgef3 UTSW 15 97760600 missense probably damaging 1.00
R4812:Rapgef3 UTSW 15 97753803 missense probably benign 0.21
R4928:Rapgef3 UTSW 15 97757375 missense probably damaging 1.00
R5161:Rapgef3 UTSW 15 97757725 missense probably damaging 1.00
R5442:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R5652:Rapgef3 UTSW 15 97758437 missense probably benign 0.00
R5837:Rapgef3 UTSW 15 97757342 splice site probably benign
R6056:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R6167:Rapgef3 UTSW 15 97767411 unclassified probably benign
R6694:Rapgef3 UTSW 15 97759984 missense probably benign 0.03
R7039:Rapgef3 UTSW 15 97761568 missense probably benign 0.01
R7154:Rapgef3 UTSW 15 97753877 missense probably benign
R7380:Rapgef3 UTSW 15 97766791 missense probably benign 0.00
R7655:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7656:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7754:Rapgef3 UTSW 15 97757746 missense probably damaging 1.00
R7849:Rapgef3 UTSW 15 97758390 critical splice donor site probably null
R8061:Rapgef3 UTSW 15 97761520 missense probably benign
R8179:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
RF024:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
X0011:Rapgef3 UTSW 15 97761473 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAAGCACGTTCCTCCATTC -3'
(R):5'- CTCGTCCATAAGTGACTAGTCTCAG -3'

Sequencing Primer
(F):5'- AGCACGTTCCTCCATTCTCTGTG -3'
(R):5'- CATAAGTGACTAGTCTCAGGTGCTG -3'
Posted On2020-06-30