Incidental Mutation 'R8117:Vmn2r111'
ID631304
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8117 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22571488 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 179 (H179L)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect probably benign
Transcript: ENSMUST00000092491
AA Change: H179L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: H179L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Cntn5 A G 9: 9,673,950 S716P probably benign Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Cyb561d2 C T 9: 107,541,572 A18T probably benign Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg1c C T 18: 20,276,959 H495Y probably benign Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kctd19 T A 8: 105,395,437 D109V unknown Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Rapgef3 A T 15: 97,750,866 D619E probably benign Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTGACTGGAATCATGTTGACAAAG -3'
(R):5'- TTGATGGGGCTTCCACATTGC -3'

Sequencing Primer
(F):5'- GGCAAAGCACACTGTGTATTTTTCC -3'
(R):5'- GGCTTCCACATTGCCTTATATGAAAC -3'
Posted On2020-06-30