Mutagenetix > Incidental Mutation

Incidental Mutation 'R8117:Vmn2r111'

631304

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8117 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22571488 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 179 (H179L)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: H179L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: H179L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.5%
20x: 94.4%

Validation Efficiency

99% (73/74)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,448	T14A		Het
2610008E11Rik	T	C	10: 79,094,455	N42D	probably benign	Het
Ankrd54	T	A	15: 79,055,441	M183L		Het
Apob	G	A	12: 8,006,435	G1639D	probably damaging	Het
B3gat2	A	G	1: 23,844,980	T283A	probably benign	Het
Bmpr2	T	G	1: 59,847,093	S296R	probably damaging	Het
Cand1	G	A	10: 119,206,816	T1123I	probably damaging	Het
Cc2d2a	T	C	5: 43,712,439	F943S	probably damaging	Het
Ccdc40	T	C	11: 119,253,385	I912T	probably benign	Het
Cdkn2d	G	A	9: 21,289,151	S108L	probably benign	Het
Cep295	G	A	9: 15,334,364	T932I	probably damaging	Het
Cntn5	A	G	9: 9,673,950	S716P	probably benign	Het
Col18a1	T	C	10: 77,059,974	E903G	probably benign	Het
Ctrc	T	A	4: 141,838,661	I229F	probably damaging	Het
Cyb561d2	C	T	9: 107,541,572	A18T	probably benign	Het
Dnajb4	T	A	3: 152,193,452	K46*	probably null	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Dsg1c	C	T	18: 20,276,959	H495Y	probably benign	Het
Eif2b3	A	G	4: 117,022,217	D18G	probably damaging	Het
Enam	A	T	5: 88,503,526	I965L	probably benign	Het
Fhod3	T	A	18: 25,115,853	I1363K	probably damaging	Het
Fras1	A	G	5: 96,707,386	Y1918C	probably damaging	Het
Fsip2	T	A	2: 82,992,952	I6343N	possibly damaging	Het
Gm15922	G	A	7: 3,737,076	T340I	probably damaging	Het
Gm996	A	G	2: 25,579,234	F222L	probably benign	Het
Gpr45	G	C	1: 43,033,315	V373L	probably damaging	Het
Hdac2	G	T	10: 36,997,970	Q365H	probably damaging	Het
Hspa12b	A	G	2: 131,138,469	T103A	possibly damaging	Het
Ifrd1	A	T	12: 40,212,351	S287T	probably benign	Het
Igkv6-15	G	A	6: 70,406,638	P60S	possibly damaging	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Kctd19	T	A	8: 105,395,437	D109V	unknown	Het
Matn4	G	A	2: 164,392,931	S540L	probably damaging	Het
Matn4	T	C	2: 164,399,762	K248E	probably benign	Het
Muc16	G	A	9: 18,508,910	Q97*	probably null	Het
Mup18	A	G	4: 61,674,001	C9R	unknown	Het
Myh1	A	G	11: 67,222,205	K1845R	probably damaging	Het
Mysm1	G	A	4: 94,960,390	R469*	probably null	Het
Naip1	T	C	13: 100,427,001	D552G	possibly damaging	Het
Nrcam	A	G	12: 44,571,588	D787G	probably benign	Het
Nrcam	G	A	12: 44,598,582	V1256I	probably damaging	Het
Obscn	G	T	11: 59,042,154	H4799N	possibly damaging	Het
Olfr1192-ps1	A	G	2: 88,652,385	K78E	probably damaging	Het
Olfr1366	T	C	13: 21,537,952	K3E	probably benign	Het
Olfr670	T	C	7: 104,960,149	I194M	probably damaging	Het
Olfr837	A	G	9: 19,137,057	I21M	probably benign	Het
Pcdhgb5	T	C	18: 37,733,249	F699S	probably damaging	Het
Phtf2	T	C	5: 20,802,040	E175G	probably benign	Het
Ppp2r5c	A	G	12: 110,551,085	H218R	possibly damaging	Het
Ptgs2	A	G	1: 150,104,034	R297G	probably damaging	Het
Rapgef3	A	T	15: 97,750,866	D619E	probably benign	Het
Ric1	G	A	19: 29,574,791	V321I	probably benign	Het
Ripor1	T	C	8: 105,617,473	V413A	probably damaging	Het
Rsf1	G	T	7: 97,639,257		probably null	Het
Sccpdh	A	G	1: 179,676,452	D122G	probably damaging	Het
Sec16a	A	T	2: 26,441,429	H191Q	probably benign	Het
Slco1a5	G	T	6: 142,262,692	N124K	probably damaging	Het
Snrnp200	A	G	2: 127,229,131	T1111A	probably benign	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Tanc2	T	A	11: 105,835,162	V384E	probably damaging	Het
Tbrg1	A	G	9: 37,657,000	F49L	possibly damaging	Het
Tecta	A	G	9: 42,377,631	F546S	probably damaging	Het
Tmem132c	A	G	5: 127,360,112	R222G	probably benign	Het
Trub2	C	T	2: 29,778,727		probably null	Het
Tti1	G	T	2: 158,007,498	P607Q	probably damaging	Het
Vmn1r62	T	A	7: 5,675,727	F136I	possibly damaging	Het
Wdfy4	A	T	14: 32,977,106	C2703*	probably null	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Wipf3	A	G	6: 54,483,831	K88R	probably benign	Het
Zfp641	C	T	15: 98,288,975	G256R	probably damaging	Het
Zfp993	T	A	4: 146,657,515	C99S	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTGACTGGAATCATGTTGACAAAG -3'
(R):5'- TTGATGGGGCTTCCACATTGC -3'

Sequencing Primer
(F):5'- GGCAAAGCACACTGTGTATTTTTCC -3'
(R):5'- GGCTTCCACATTGCCTTATATGAAAC -3'

Posted On

2020-06-30