Incidental Mutation 'R8117:Dsc2'
ID 631305
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 067546-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8117 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20165331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,058,078 (GRCm39) T14A Het
2610008E11Rik T C 10: 78,930,289 (GRCm39) N42D probably benign Het
Ajm1 A G 2: 25,469,246 (GRCm39) F222L probably benign Het
Ankrd54 T A 15: 78,939,641 (GRCm39) M183L Het
Apob G A 12: 8,056,435 (GRCm39) G1639D probably damaging Het
B3gat2 A G 1: 23,884,061 (GRCm39) T283A probably benign Het
Bmpr2 T G 1: 59,886,252 (GRCm39) S296R probably damaging Het
Cand1 G A 10: 119,042,721 (GRCm39) T1123I probably damaging Het
Cc2d2a T C 5: 43,869,781 (GRCm39) F943S probably damaging Het
Ccdc40 T C 11: 119,144,211 (GRCm39) I912T probably benign Het
Cdkn2d G A 9: 21,200,447 (GRCm39) S108L probably benign Het
Cep295 G A 9: 15,245,660 (GRCm39) T932I probably damaging Het
Cntn5 A G 9: 9,673,955 (GRCm39) S716P probably benign Het
Col18a1 T C 10: 76,895,808 (GRCm39) E903G probably benign Het
Ctrc T A 4: 141,565,972 (GRCm39) I229F probably damaging Het
Cyb561d2 C T 9: 107,418,771 (GRCm39) A18T probably benign Het
Dnajb4 T A 3: 151,899,089 (GRCm39) K46* probably null Het
Dsg1c C T 18: 20,410,016 (GRCm39) H495Y probably benign Het
Eif2b3 A G 4: 116,879,414 (GRCm39) D18G probably damaging Het
Enam A T 5: 88,651,385 (GRCm39) I965L probably benign Het
Fhod3 T A 18: 25,248,910 (GRCm39) I1363K probably damaging Het
Fras1 A G 5: 96,855,245 (GRCm39) Y1918C probably damaging Het
Fsip2 T A 2: 82,823,296 (GRCm39) I6343N possibly damaging Het
Gpr45 G C 1: 43,072,475 (GRCm39) V373L probably damaging Het
Hdac2 G T 10: 36,873,966 (GRCm39) Q365H probably damaging Het
Hspa12b A G 2: 130,980,389 (GRCm39) T103A possibly damaging Het
Ifrd1 A T 12: 40,262,350 (GRCm39) S287T probably benign Het
Igkv6-15 G A 6: 70,383,622 (GRCm39) P60S possibly damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Kctd19 T A 8: 106,122,069 (GRCm39) D109V unknown Het
Matn4 G A 2: 164,234,851 (GRCm39) S540L probably damaging Het
Matn4 T C 2: 164,241,682 (GRCm39) K248E probably benign Het
Muc16 G A 9: 18,420,206 (GRCm39) Q97* probably null Het
Mup18 A G 4: 61,592,238 (GRCm39) C9R unknown Het
Myh1 A G 11: 67,113,031 (GRCm39) K1845R probably damaging Het
Mysm1 G A 4: 94,848,627 (GRCm39) R469* probably null Het
Naip1 T C 13: 100,563,509 (GRCm39) D552G possibly damaging Het
Nrcam A G 12: 44,618,371 (GRCm39) D787G probably benign Het
Nrcam G A 12: 44,645,365 (GRCm39) V1256I probably damaging Het
Obscn G T 11: 58,932,980 (GRCm39) H4799N possibly damaging Het
Or1f12 T C 13: 21,722,122 (GRCm39) K3E probably benign Het
Or4p4 A G 2: 88,482,729 (GRCm39) K78E probably damaging Het
Or52e18 T C 7: 104,609,356 (GRCm39) I194M probably damaging Het
Or7g22 A G 9: 19,048,353 (GRCm39) I21M probably benign Het
Pcdhgb5 T C 18: 37,866,302 (GRCm39) F699S probably damaging Het
Phtf2 T C 5: 21,007,038 (GRCm39) E175G probably benign Het
Pira1 G A 7: 3,740,075 (GRCm39) T340I probably damaging Het
Ppp2r5c A G 12: 110,517,519 (GRCm39) H218R possibly damaging Het
Ptgs2 A G 1: 149,979,785 (GRCm39) R297G probably damaging Het
Rapgef3 A T 15: 97,648,747 (GRCm39) D619E probably benign Het
Ric1 G A 19: 29,552,191 (GRCm39) V321I probably benign Het
Ripor1 T C 8: 106,344,105 (GRCm39) V413A probably damaging Het
Rsf1 G T 7: 97,288,464 (GRCm39) probably null Het
Sccpdh A G 1: 179,504,017 (GRCm39) D122G probably damaging Het
Sec16a A T 2: 26,331,441 (GRCm39) H191Q probably benign Het
Slco1a5 G T 6: 142,208,418 (GRCm39) N124K probably damaging Het
Snrnp200 A G 2: 127,071,051 (GRCm39) T1111A probably benign Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Tanc2 T A 11: 105,725,988 (GRCm39) V384E probably damaging Het
Tbrg1 A G 9: 37,568,296 (GRCm39) F49L possibly damaging Het
Tecta A G 9: 42,288,927 (GRCm39) F546S probably damaging Het
Tmem132c A G 5: 127,437,176 (GRCm39) R222G probably benign Het
Trub2 C T 2: 29,668,739 (GRCm39) probably null Het
Tti1 G T 2: 157,849,418 (GRCm39) P607Q probably damaging Het
Vmn1r62 T A 7: 5,678,726 (GRCm39) F136I possibly damaging Het
Vmn2r111 T A 17: 22,790,469 (GRCm39) H179L probably benign Het
Wdfy4 A T 14: 32,699,063 (GRCm39) C2703* probably null Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wipf3 A G 6: 54,460,816 (GRCm39) K88R probably benign Het
Zfp641 C T 15: 98,186,856 (GRCm39) G256R probably damaging Het
Zfp993 T A 4: 146,741,972 (GRCm39) C99S probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- GAAACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On 2020-06-30