Mutagenetix > Incidental Mutation

Incidental Mutation 'R8117:Dsc2'

631305

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8117 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20032274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 881 (G881R)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably benign
Transcript: ENSMUST00000039247

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.1423

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.5%
20x: 94.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,448	T14A		Het
2610008E11Rik	T	C	10: 79,094,455	N42D	probably benign	Het
Ankrd54	T	A	15: 79,055,441	M183L		Het
Apob	G	A	12: 8,006,435	G1639D	probably damaging	Het
B3gat2	A	G	1: 23,844,980	T283A	probably benign	Het
Bmpr2	T	G	1: 59,847,093	S296R	probably damaging	Het
Cand1	G	A	10: 119,206,816	T1123I	probably damaging	Het
Cc2d2a	T	C	5: 43,712,439	F943S	probably damaging	Het
Ccdc40	T	C	11: 119,253,385	I912T	probably benign	Het
Cdkn2d	G	A	9: 21,289,151	S108L	probably benign	Het
Cep295	G	A	9: 15,334,364	T932I	probably damaging	Het
Cntn5	A	G	9: 9,673,950	S716P	probably benign	Het
Col18a1	T	C	10: 77,059,974	E903G	probably benign	Het
Ctrc	T	A	4: 141,838,661	I229F	probably damaging	Het
Cyb561d2	C	T	9: 107,541,572	A18T	probably benign	Het
Dnajb4	T	A	3: 152,193,452	K46*	probably null	Het
Dsg1c	C	T	18: 20,276,959	H495Y	probably benign	Het
Eif2b3	A	G	4: 117,022,217	D18G	probably damaging	Het
Enam	A	T	5: 88,503,526	I965L	probably benign	Het
Fhod3	T	A	18: 25,115,853	I1363K	probably damaging	Het
Fras1	A	G	5: 96,707,386	Y1918C	probably damaging	Het
Fsip2	T	A	2: 82,992,952	I6343N	possibly damaging	Het
Gm15922	G	A	7: 3,737,076	T340I	probably damaging	Het
Gm996	A	G	2: 25,579,234	F222L	probably benign	Het
Gpr45	G	C	1: 43,033,315	V373L	probably damaging	Het
Hdac2	G	T	10: 36,997,970	Q365H	probably damaging	Het
Hspa12b	A	G	2: 131,138,469	T103A	possibly damaging	Het
Ifrd1	A	T	12: 40,212,351	S287T	probably benign	Het
Igkv6-15	G	A	6: 70,406,638	P60S	possibly damaging	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Kctd19	T	A	8: 105,395,437	D109V	unknown	Het
Matn4	G	A	2: 164,392,931	S540L	probably damaging	Het
Matn4	T	C	2: 164,399,762	K248E	probably benign	Het
Muc16	G	A	9: 18,508,910	Q97*	probably null	Het
Mup18	A	G	4: 61,674,001	C9R	unknown	Het
Myh1	A	G	11: 67,222,205	K1845R	probably damaging	Het
Mysm1	G	A	4: 94,960,390	R469*	probably null	Het
Naip1	T	C	13: 100,427,001	D552G	possibly damaging	Het
Nrcam	A	G	12: 44,571,588	D787G	probably benign	Het
Nrcam	G	A	12: 44,598,582	V1256I	probably damaging	Het
Obscn	G	T	11: 59,042,154	H4799N	possibly damaging	Het
Olfr1192-ps1	A	G	2: 88,652,385	K78E	probably damaging	Het
Olfr1366	T	C	13: 21,537,952	K3E	probably benign	Het
Olfr670	T	C	7: 104,960,149	I194M	probably damaging	Het
Olfr837	A	G	9: 19,137,057	I21M	probably benign	Het
Pcdhgb5	T	C	18: 37,733,249	F699S	probably damaging	Het
Phtf2	T	C	5: 20,802,040	E175G	probably benign	Het
Ppp2r5c	A	G	12: 110,551,085	H218R	possibly damaging	Het
Ptgs2	A	G	1: 150,104,034	R297G	probably damaging	Het
Rapgef3	A	T	15: 97,750,866	D619E	probably benign	Het
Ric1	G	A	19: 29,574,791	V321I	probably benign	Het
Ripor1	T	C	8: 105,617,473	V413A	probably damaging	Het
Rsf1	G	T	7: 97,639,257		probably null	Het
Sccpdh	A	G	1: 179,676,452	D122G	probably damaging	Het
Sec16a	A	T	2: 26,441,429	H191Q	probably benign	Het
Slco1a5	G	T	6: 142,262,692	N124K	probably damaging	Het
Snrnp200	A	G	2: 127,229,131	T1111A	probably benign	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Tanc2	T	A	11: 105,835,162	V384E	probably damaging	Het
Tbrg1	A	G	9: 37,657,000	F49L	possibly damaging	Het
Tecta	A	G	9: 42,377,631	F546S	probably damaging	Het
Tmem132c	A	G	5: 127,360,112	R222G	probably benign	Het
Trub2	C	T	2: 29,778,727		probably null	Het
Tti1	G	T	2: 158,007,498	P607Q	probably damaging	Het
Vmn1r62	T	A	7: 5,675,727	F136I	possibly damaging	Het
Vmn2r111	T	A	17: 22,571,488	H179L	probably benign	Het
Wdfy4	A	T	14: 32,977,106	C2703*	probably null	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Wipf3	A	G	6: 54,483,831	K88R	probably benign	Het
Zfp641	C	T	15: 98,288,975	G256R	probably damaging	Het
Zfp993	T	A	4: 146,657,515	C99S	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- GAAACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'

Posted On

2020-06-30