Incidental Mutation 'R8117:Dsc2'
ID631305
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8117 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20032274 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Cntn5 A G 9: 9,673,950 S716P probably benign Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Cyb561d2 C T 9: 107,541,572 A18T probably benign Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsg1c C T 18: 20,276,959 H495Y probably benign Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kctd19 T A 8: 105,395,437 D109V unknown Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Rapgef3 A T 15: 97,750,866 D619E probably benign Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Vmn2r111 T A 17: 22,571,488 H179L probably benign Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGCAGACCGAGATAGGAG -3'
(R):5'- GAAACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On2020-06-30