Incidental Mutation 'R8117:Dsg1c'
ID631306
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8117 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20276959 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 495 (H495Y)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably benign
Transcript: ENSMUST00000054128
AA Change: H495Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: H495Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Cntn5 A G 9: 9,673,950 S716P probably benign Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Cyb561d2 C T 9: 107,541,572 A18T probably benign Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kctd19 T A 8: 105,395,437 D109V unknown Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Rapgef3 A T 15: 97,750,866 D619E probably benign Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Vmn2r111 T A 17: 22,571,488 H179L probably benign Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
R8048:Dsg1c UTSW 18 20274767 missense probably damaging 1.00
R8092:Dsg1c UTSW 18 20281972 missense probably damaging 1.00
R8103:Dsg1c UTSW 18 20283114 missense probably damaging 1.00
R8192:Dsg1c UTSW 18 20266198 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Z1176:Dsg1c UTSW 18 20283573 missense probably damaging 1.00
Z1177:Dsg1c UTSW 18 20264949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAACAATTGCTTTCCAAGG -3'
(R):5'- ACTGAACACGTAGGCTGTTTG -3'

Sequencing Primer
(F):5'- TTCCAAGGATGAGAGTTTCCAGAACC -3'
(R):5'- ACTGAACACGTAGGCTGTTTGATTTC -3'
Posted On2020-06-30