Incidental Mutation 'R8118:Mcmdc2'
ID631310
Institutional Source Beutler Lab
Gene Symbol Mcmdc2
Ensembl Gene ENSMUSG00000046101
Gene Nameminichromosome maintenance domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location9908638-9942085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9916374 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 166 (N166K)
Ref Sequence ENSEMBL: ENSMUSP00000054715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052843] [ENSMUST00000118098] [ENSMUST00000125294] [ENSMUST00000140948] [ENSMUST00000171802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052843
AA Change: N166K

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054715
Gene: ENSMUSG00000046101
AA Change: N166K

DomainStartEndE-ValueType
Blast:MCM 101 345 1e-140 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000118098
AA Change: N180K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112851
Gene: ENSMUSG00000046101
AA Change: N180K

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000125294
AA Change: N180K

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120858
Gene: ENSMUSG00000046101
AA Change: N180K

DomainStartEndE-ValueType
Blast:MCM 115 236 3e-73 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000140948
AA Change: N180K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120577
Gene: ENSMUSG00000046101
AA Change: N180K

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171802
AA Change: N180K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128620
Gene: ENSMUSG00000046101
AA Change: N180K

DomainStartEndE-ValueType
Pfam:MCM 503 623 1.4e-9 PFAM
low complexity region 658 665 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Homozygous knockout mice of both sexes are sterile as a result of abnormal meiosis. This in turn is caused by defective double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Mcmdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02374:Mcmdc2 APN 1 9911982 missense possibly damaging 0.85
IGL03087:Mcmdc2 APN 1 9930945 missense possibly damaging 0.78
IGL03230:Mcmdc2 APN 1 9931996 unclassified probably benign
R0313:Mcmdc2 UTSW 1 9932141 missense probably damaging 1.00
R0448:Mcmdc2 UTSW 1 9940542 makesense probably null
R0685:Mcmdc2 UTSW 1 9911814 critical splice donor site probably null
R0926:Mcmdc2 UTSW 1 9920576 nonsense probably null
R1590:Mcmdc2 UTSW 1 9916555 nonsense probably null
R1867:Mcmdc2 UTSW 1 9930805 missense probably damaging 1.00
R2356:Mcmdc2 UTSW 1 9930801 missense possibly damaging 0.76
R5199:Mcmdc2 UTSW 1 9920435 missense probably benign 0.37
R5341:Mcmdc2 UTSW 1 9940917 frame shift probably null
R5459:Mcmdc2 UTSW 1 9937084 missense probably benign 0.06
R5748:Mcmdc2 UTSW 1 9911807 missense probably damaging 1.00
R6808:Mcmdc2 UTSW 1 9934017 missense probably damaging 1.00
R6908:Mcmdc2 UTSW 1 9930778 splice site probably null
R7123:Mcmdc2 UTSW 1 9940418 missense unknown
R7233:Mcmdc2 UTSW 1 9932183 critical splice donor site probably null
R7498:Mcmdc2 UTSW 1 9919077 missense probably benign
R7646:Mcmdc2 UTSW 1 9912135 missense possibly damaging 0.53
R7834:Mcmdc2 UTSW 1 9912174 critical splice donor site probably null
R8194:Mcmdc2 UTSW 1 9916642 missense probably benign
R8283:Mcmdc2 UTSW 1 9934038 missense possibly damaging 0.85
R8434:Mcmdc2 UTSW 1 9920581 missense possibly damaging 0.63
R8523:Mcmdc2 UTSW 1 9911721 start codon destroyed probably null 0.87
X0025:Mcmdc2 UTSW 1 9911966 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGCCTGAGAGGAAACAGTC -3'
(R):5'- GAGTCTCCTTGAAAAGCATGAAAC -3'

Sequencing Primer
(F):5'- TGGGCTACACAGTGATACCTGTAC -3'
(R):5'- AAGCATGAAACATTTTTGTGGTG -3'
Posted On2020-06-30