Incidental Mutation 'R8118:Or5g29'
ID 631315
Institutional Source Beutler Lab
Gene Symbol Or5g29
Ensembl Gene ENSMUSG00000111454
Gene Name olfactory receptor family 5 subfamily G member 29
Synonyms Olfr998, GA_x6K02T2Q125-47069356-47070300, MOR175-5
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.232) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85420854-85421865 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 85421332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 149 (Y149*)
Ref Sequence ENSEMBL: ENSMUSP00000150713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052307] [ENSMUST00000215083]
AlphaFold Q8VF76
Predicted Effect probably null
Transcript: ENSMUST00000052307
AA Change: Y149*
SMART Domains Protein: ENSMUSP00000059970
Gene: ENSMUSG00000111454
AA Change: Y149*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-54 PFAM
Pfam:7tm_1 41 308 9.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215083
AA Change: Y149*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,592,821 (GRCm39) D792G probably damaging Het
Adcy7 A G 8: 89,042,384 (GRCm39) H417R probably damaging Het
Agr2 A G 12: 36,046,106 (GRCm39) D79G probably benign Het
Ankle1 T C 8: 71,860,279 (GRCm39) S286P probably benign Het
Arhgef11 T C 3: 87,643,164 (GRCm39) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,789,837 (GRCm39) M421T probably damaging Het
Cdk17 C A 10: 93,052,252 (GRCm39) Q111K possibly damaging Het
Cimap2 T A 4: 106,470,595 (GRCm39) R192S possibly damaging Het
Cobl A G 11: 12,204,834 (GRCm39) S623P probably benign Het
Dgka C T 10: 128,558,318 (GRCm39) probably null Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Dsg2 A G 18: 20,715,858 (GRCm39) I267V probably benign Het
Exoc4 T C 6: 33,948,853 (GRCm39) Y899H probably damaging Het
Fat3 A G 9: 15,871,400 (GRCm39) F3664L probably benign Het
Fbxo47 C T 11: 97,770,341 (GRCm39) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
Gpr61 A G 3: 108,057,888 (GRCm39) S258P probably damaging Het
H2-T9 C T 17: 36,438,582 (GRCm39) V270M probably damaging Het
Hectd4 C T 5: 121,424,439 (GRCm39) H700Y probably benign Het
Hs3st2 C T 7: 120,996,651 (GRCm39) T154I probably benign Het
Inf2 A T 12: 112,567,871 (GRCm39) H167L probably damaging Het
Ints3 C T 3: 90,307,606 (GRCm39) probably null Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Itgal C A 7: 126,910,417 (GRCm39) Q509K probably benign Het
Klhl20 A T 1: 160,925,971 (GRCm39) probably null Het
Krtap4-13 C T 11: 99,700,224 (GRCm39) C145Y unknown Het
Large1 A G 8: 73,858,572 (GRCm39) S99P probably benign Het
Lrba A T 3: 86,261,533 (GRCm39) I1496L probably benign Het
Map2 A T 1: 66,464,550 (GRCm39) I1647F probably damaging Het
Map3k10 A G 7: 27,372,842 (GRCm39) V203A possibly damaging Het
Mcmdc2 T A 1: 9,986,599 (GRCm39) N166K possibly damaging Het
Mlxipl T G 5: 135,166,102 (GRCm39) L828R possibly damaging Het
Mnat1 A G 12: 73,265,864 (GRCm39) I253V probably benign Het
Mtfp1 A G 11: 4,043,910 (GRCm39) S107P probably damaging Het
Nebl T A 2: 17,384,631 (GRCm39) Y65F possibly damaging Het
Nelfb A T 2: 25,095,171 (GRCm39) D339E possibly damaging Het
Nlrc3 T A 16: 3,783,495 (GRCm39) I20L probably benign Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or14a258 A T 7: 86,034,976 (GRCm39) C297* probably null Het
Or1ad8 A G 11: 50,898,327 (GRCm39) H176R probably damaging Het
Or2t6 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Or4k15b T C 14: 50,272,608 (GRCm39) D84G probably benign Het
Or5b123 T A 19: 13,597,109 (GRCm39) N151K probably damaging Het
Palm3 A G 8: 84,756,438 (GRCm39) E650G probably damaging Het
Prps1l1 C A 12: 35,035,340 (GRCm39) L152M probably damaging Het
Rgs7bp C A 13: 105,189,629 (GRCm39) V57F probably damaging Het
Scaf8 T A 17: 3,214,458 (GRCm39) V171D unknown Het
Sf3a2 T C 10: 80,639,474 (GRCm39) Y155H probably damaging Het
Sfrp1 T G 8: 23,902,000 (GRCm39) L67R probably damaging Het
Shank2 A T 7: 143,963,612 (GRCm39) I407L probably benign Het
Skint6 T C 4: 112,722,872 (GRCm39) T902A possibly damaging Het
Skint6 A C 4: 113,013,691 (GRCm39) S353R possibly damaging Het
Srrm2 T A 17: 24,027,057 (GRCm39) I87N unknown Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svs3b A G 2: 164,097,926 (GRCm39) S132P probably damaging Het
Tbc1d17 G T 7: 44,492,426 (GRCm39) F412L probably benign Het
Tex29 A T 8: 11,904,263 (GRCm39) E116D unknown Het
Tmem204 T C 17: 25,299,312 (GRCm39) D69G possibly damaging Het
Ttll10 G A 4: 156,129,219 (GRCm39) R308C probably benign Het
Ttn T A 2: 76,577,508 (GRCm39) I24462F probably damaging Het
Tubg2 A G 11: 101,052,304 (GRCm39) E411G probably damaging Het
Ugt2b38 T C 5: 87,571,630 (GRCm39) N134S probably damaging Het
Usp31 T C 7: 121,276,485 (GRCm39) T351A probably damaging Het
Usp33 T C 3: 152,065,996 (GRCm39) L92S probably damaging Het
Vmn2r20 A T 6: 123,373,429 (GRCm39) I471N probably damaging Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wnk2 A G 13: 49,244,459 (GRCm39) V459A probably damaging Het
Other mutations in Or5g29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Or5g29 APN 2 85,421,691 (GRCm39) missense probably benign 0.00
R0091:Or5g29 UTSW 2 85,421,696 (GRCm39) missense probably benign 0.38
R0241:Or5g29 UTSW 2 85,421,154 (GRCm39) missense probably benign 0.20
R0241:Or5g29 UTSW 2 85,421,154 (GRCm39) missense probably benign 0.20
R0268:Or5g29 UTSW 2 85,421,645 (GRCm39) missense possibly damaging 0.78
R0481:Or5g29 UTSW 2 85,421,448 (GRCm39) missense possibly damaging 0.94
R1816:Or5g29 UTSW 2 85,421,269 (GRCm39) missense probably benign 0.00
R1988:Or5g29 UTSW 2 85,420,985 (GRCm39) missense probably benign 0.00
R2008:Or5g29 UTSW 2 85,421,766 (GRCm39) missense probably damaging 1.00
R2060:Or5g29 UTSW 2 85,421,627 (GRCm39) missense possibly damaging 0.78
R2273:Or5g29 UTSW 2 85,420,932 (GRCm39) missense probably damaging 1.00
R4409:Or5g29 UTSW 2 85,421,274 (GRCm39) missense probably damaging 1.00
R4783:Or5g29 UTSW 2 85,421,282 (GRCm39) missense probably benign 0.03
R4785:Or5g29 UTSW 2 85,421,282 (GRCm39) missense probably benign 0.03
R5098:Or5g29 UTSW 2 85,420,976 (GRCm39) missense probably benign 0.00
R5176:Or5g29 UTSW 2 85,421,779 (GRCm39) missense possibly damaging 0.88
R5462:Or5g29 UTSW 2 85,421,640 (GRCm39) missense probably damaging 1.00
R6092:Or5g29 UTSW 2 85,420,950 (GRCm39) missense probably benign 0.14
R6278:Or5g29 UTSW 2 85,421,342 (GRCm39) missense probably benign 0.00
R7022:Or5g29 UTSW 2 85,420,942 (GRCm39) missense probably benign 0.01
R7673:Or5g29 UTSW 2 85,421,406 (GRCm39) missense possibly damaging 0.75
R8054:Or5g29 UTSW 2 85,421,184 (GRCm39) missense probably damaging 1.00
R8940:Or5g29 UTSW 2 85,421,528 (GRCm39) missense probably benign
R9617:Or5g29 UTSW 2 85,421,279 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCTCCTAAGATGCTCTGTG -3'
(R):5'- GAACACTCCTATGGCTCCAG -3'

Sequencing Primer
(F):5'- AGCTCCTAAGATGCTCTGTGATATC -3'
(R):5'- TCCTATGGCTCCAGAAAGAAC -3'
Posted On 2020-06-30