Incidental Mutation 'R8118:Olfr998'
ID631315
Institutional Source Beutler Lab
Gene Symbol Olfr998
Ensembl Gene ENSMUSG00000111454
Gene Nameolfactory receptor 998
SynonymsGA_x6K02T2Q125-47069356-47070300, MOR175-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85588948-85591893 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85590988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 149 (Y149*)
Ref Sequence ENSEMBL: ENSMUSP00000150713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052307] [ENSMUST00000215083]
Predicted Effect probably null
Transcript: ENSMUST00000052307
AA Change: Y149*
SMART Domains Protein: ENSMUSP00000059970
Gene: ENSMUSG00000111454
AA Change: Y149*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-54 PFAM
Pfam:7tm_1 41 308 9.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215083
AA Change: Y149*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Olfr998
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Olfr998 APN 2 85591347 missense probably benign 0.00
R0091:Olfr998 UTSW 2 85591352 missense probably benign 0.38
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0241:Olfr998 UTSW 2 85590810 missense probably benign 0.20
R0268:Olfr998 UTSW 2 85591301 missense possibly damaging 0.78
R0481:Olfr998 UTSW 2 85591104 missense possibly damaging 0.94
R1816:Olfr998 UTSW 2 85590925 missense probably benign 0.00
R1988:Olfr998 UTSW 2 85590641 missense probably benign 0.00
R2008:Olfr998 UTSW 2 85591422 missense probably damaging 1.00
R2060:Olfr998 UTSW 2 85591283 missense possibly damaging 0.78
R2273:Olfr998 UTSW 2 85590588 missense probably damaging 1.00
R4409:Olfr998 UTSW 2 85590930 missense probably damaging 1.00
R4783:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R4785:Olfr998 UTSW 2 85590938 missense probably benign 0.03
R5098:Olfr998 UTSW 2 85590632 missense probably benign 0.00
R5176:Olfr998 UTSW 2 85591435 missense possibly damaging 0.88
R5462:Olfr998 UTSW 2 85591296 missense probably damaging 1.00
R6092:Olfr998 UTSW 2 85590606 missense probably benign 0.14
R6278:Olfr998 UTSW 2 85590998 missense probably benign 0.00
R7022:Olfr998 UTSW 2 85590598 missense probably benign 0.01
R7673:Olfr998 UTSW 2 85591062 missense possibly damaging 0.75
R8054:Olfr998 UTSW 2 85590840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCTCCTAAGATGCTCTGTG -3'
(R):5'- GAACACTCCTATGGCTCCAG -3'

Sequencing Primer
(F):5'- AGCTCCTAAGATGCTCTGTGATATC -3'
(R):5'- TCCTATGGCTCCAGAAAGAAC -3'
Posted On2020-06-30