Incidental Mutation 'R8118:Gpr61'
ID 631320
Institutional Source Beutler Lab
Gene Symbol Gpr61
Ensembl Gene ENSMUSG00000046793
Gene Name G protein-coupled receptor 61
Synonyms
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 108055660-108062218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108057888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 258 (S258P)
Ref Sequence ENSEMBL: ENSMUSP00000055557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000001] [ENSMUST00000062028] [ENSMUST00000116284]
AlphaFold Q8C010
Predicted Effect probably benign
Transcript: ENSMUST00000000001
SMART Domains Protein: ENSMUSP00000000001
Gene: ENSMUSG00000000001

DomainStartEndE-ValueType
G_alpha 13 353 4.43e-218 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062028
AA Change: S258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055557
Gene: ENSMUSG00000046793
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:7tm_1 59 341 1.7e-36 PFAM
low complexity region 394 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116284
AA Change: S258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111988
Gene: ENSMUSG00000046793
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:7tm_1 59 341 4.2e-41 PFAM
low complexity region 394 406 N/A INTRINSIC
Meta Mutation Damage Score 0.3913 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family. G protein-coupled receptors contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. The protein encoded by this gene is most closely related to biogenic amine receptors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,592,821 (GRCm39) D792G probably damaging Het
Adcy7 A G 8: 89,042,384 (GRCm39) H417R probably damaging Het
Agr2 A G 12: 36,046,106 (GRCm39) D79G probably benign Het
Ankle1 T C 8: 71,860,279 (GRCm39) S286P probably benign Het
Arhgef11 T C 3: 87,643,164 (GRCm39) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,789,837 (GRCm39) M421T probably damaging Het
Cdk17 C A 10: 93,052,252 (GRCm39) Q111K possibly damaging Het
Cimap2 T A 4: 106,470,595 (GRCm39) R192S possibly damaging Het
Cobl A G 11: 12,204,834 (GRCm39) S623P probably benign Het
Dgka C T 10: 128,558,318 (GRCm39) probably null Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Dsg2 A G 18: 20,715,858 (GRCm39) I267V probably benign Het
Exoc4 T C 6: 33,948,853 (GRCm39) Y899H probably damaging Het
Fat3 A G 9: 15,871,400 (GRCm39) F3664L probably benign Het
Fbxo47 C T 11: 97,770,341 (GRCm39) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
H2-T9 C T 17: 36,438,582 (GRCm39) V270M probably damaging Het
Hectd4 C T 5: 121,424,439 (GRCm39) H700Y probably benign Het
Hs3st2 C T 7: 120,996,651 (GRCm39) T154I probably benign Het
Inf2 A T 12: 112,567,871 (GRCm39) H167L probably damaging Het
Ints3 C T 3: 90,307,606 (GRCm39) probably null Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Itgal C A 7: 126,910,417 (GRCm39) Q509K probably benign Het
Klhl20 A T 1: 160,925,971 (GRCm39) probably null Het
Krtap4-13 C T 11: 99,700,224 (GRCm39) C145Y unknown Het
Large1 A G 8: 73,858,572 (GRCm39) S99P probably benign Het
Lrba A T 3: 86,261,533 (GRCm39) I1496L probably benign Het
Map2 A T 1: 66,464,550 (GRCm39) I1647F probably damaging Het
Map3k10 A G 7: 27,372,842 (GRCm39) V203A possibly damaging Het
Mcmdc2 T A 1: 9,986,599 (GRCm39) N166K possibly damaging Het
Mlxipl T G 5: 135,166,102 (GRCm39) L828R possibly damaging Het
Mnat1 A G 12: 73,265,864 (GRCm39) I253V probably benign Het
Mtfp1 A G 11: 4,043,910 (GRCm39) S107P probably damaging Het
Nebl T A 2: 17,384,631 (GRCm39) Y65F possibly damaging Het
Nelfb A T 2: 25,095,171 (GRCm39) D339E possibly damaging Het
Nlrc3 T A 16: 3,783,495 (GRCm39) I20L probably benign Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or14a258 A T 7: 86,034,976 (GRCm39) C297* probably null Het
Or1ad8 A G 11: 50,898,327 (GRCm39) H176R probably damaging Het
Or2t6 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Or4k15b T C 14: 50,272,608 (GRCm39) D84G probably benign Het
Or5b123 T A 19: 13,597,109 (GRCm39) N151K probably damaging Het
Or5g29 T A 2: 85,421,332 (GRCm39) Y149* probably null Het
Palm3 A G 8: 84,756,438 (GRCm39) E650G probably damaging Het
Prps1l1 C A 12: 35,035,340 (GRCm39) L152M probably damaging Het
Rgs7bp C A 13: 105,189,629 (GRCm39) V57F probably damaging Het
Scaf8 T A 17: 3,214,458 (GRCm39) V171D unknown Het
Sf3a2 T C 10: 80,639,474 (GRCm39) Y155H probably damaging Het
Sfrp1 T G 8: 23,902,000 (GRCm39) L67R probably damaging Het
Shank2 A T 7: 143,963,612 (GRCm39) I407L probably benign Het
Skint6 T C 4: 112,722,872 (GRCm39) T902A possibly damaging Het
Skint6 A C 4: 113,013,691 (GRCm39) S353R possibly damaging Het
Srrm2 T A 17: 24,027,057 (GRCm39) I87N unknown Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svs3b A G 2: 164,097,926 (GRCm39) S132P probably damaging Het
Tbc1d17 G T 7: 44,492,426 (GRCm39) F412L probably benign Het
Tex29 A T 8: 11,904,263 (GRCm39) E116D unknown Het
Tmem204 T C 17: 25,299,312 (GRCm39) D69G possibly damaging Het
Ttll10 G A 4: 156,129,219 (GRCm39) R308C probably benign Het
Ttn T A 2: 76,577,508 (GRCm39) I24462F probably damaging Het
Tubg2 A G 11: 101,052,304 (GRCm39) E411G probably damaging Het
Ugt2b38 T C 5: 87,571,630 (GRCm39) N134S probably damaging Het
Usp31 T C 7: 121,276,485 (GRCm39) T351A probably damaging Het
Usp33 T C 3: 152,065,996 (GRCm39) L92S probably damaging Het
Vmn2r20 A T 6: 123,373,429 (GRCm39) I471N probably damaging Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wnk2 A G 13: 49,244,459 (GRCm39) V459A probably damaging Het
Other mutations in Gpr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Gpr61 APN 3 108,058,514 (GRCm39) missense probably damaging 1.00
IGL02354:Gpr61 APN 3 108,057,534 (GRCm39) missense probably damaging 1.00
IGL02878:Gpr61 APN 3 108,057,344 (GRCm39) missense probably damaging 0.97
R1061:Gpr61 UTSW 3 108,057,623 (GRCm39) missense probably damaging 1.00
R1295:Gpr61 UTSW 3 108,057,797 (GRCm39) missense possibly damaging 0.78
R1296:Gpr61 UTSW 3 108,057,797 (GRCm39) missense possibly damaging 0.78
R1329:Gpr61 UTSW 3 108,057,830 (GRCm39) missense probably benign 0.16
R1718:Gpr61 UTSW 3 108,057,696 (GRCm39) missense possibly damaging 0.81
R1840:Gpr61 UTSW 3 108,057,797 (GRCm39) missense possibly damaging 0.78
R2139:Gpr61 UTSW 3 108,058,077 (GRCm39) missense probably damaging 1.00
R5016:Gpr61 UTSW 3 108,057,983 (GRCm39) missense possibly damaging 0.63
R7042:Gpr61 UTSW 3 108,058,647 (GRCm39) missense possibly damaging 0.93
R7689:Gpr61 UTSW 3 108,057,966 (GRCm39) missense probably damaging 1.00
R8058:Gpr61 UTSW 3 108,058,211 (GRCm39) missense probably damaging 1.00
R8931:Gpr61 UTSW 3 108,057,470 (GRCm39) missense probably benign
R9063:Gpr61 UTSW 3 108,057,555 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAATCCAGGTTACCACGTTC -3'
(R):5'- TCCAATGGAGCCATAGTGCC -3'

Sequencing Primer
(F):5'- ACCTGTCCTGCTGAAATGG -3'
(R):5'- CAATGGAGCCATAGTGCCTACTG -3'
Posted On 2020-06-30