Incidental Mutation 'R8118:Lexm'
ID 631322
Institutional Source Beutler Lab
Gene Symbol Lexm
Ensembl Gene ENSMUSG00000054362
Gene Name lymphocyte expansion molecule
Synonyms BC055111
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106590909-106617241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106613398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 192 (R192S)
Ref Sequence ENSEMBL: ENSMUSP00000139868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067387] [ENSMUST00000106788] [ENSMUST00000189032]
AlphaFold A2AVQ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000067387
AA Change: R192S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066732
Gene: ENSMUSG00000054362
AA Change: R192S

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106788
AA Change: R192S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102400
Gene: ENSMUSG00000054362
AA Change: R192S

DomainStartEndE-ValueType
internal_repeat_1 62 146 2.56e-5 PROSPERO
low complexity region 157 173 N/A INTRINSIC
internal_repeat_1 204 279 2.56e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000189032
AA Change: R192S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139868
Gene: ENSMUSG00000054362
AA Change: R192S

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Heterozygous null mice show decreased CD8-positive, alpha-beta T cell number and decreased cytotoxic T cell cytolysis in response to lymphocytic choriomeningitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Lexm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Lexm APN 4 106591628 missense possibly damaging 0.86
IGL02583:Lexm APN 4 106611405 splice site probably benign
IGL03329:Lexm APN 4 106607404 missense possibly damaging 0.92
R0294:Lexm UTSW 4 106613164 missense probably damaging 1.00
R1875:Lexm UTSW 4 106613256 splice site probably benign
R2960:Lexm UTSW 4 106613418 missense probably damaging 1.00
R4654:Lexm UTSW 4 106610415 missense probably benign 0.03
R4836:Lexm UTSW 4 106610527 critical splice acceptor site probably null
R5436:Lexm UTSW 4 106610493 missense probably benign 0.00
R6086:Lexm UTSW 4 106613206 missense probably damaging 1.00
R6580:Lexm UTSW 4 106611514 missense possibly damaging 0.73
R6952:Lexm UTSW 4 106610399 critical splice donor site probably null
R7995:Lexm UTSW 4 106615915 missense probably benign 0.33
R8258:Lexm UTSW 4 106591662 missense probably damaging 1.00
R9260:Lexm UTSW 4 106615437 missense probably benign 0.00
Z1176:Lexm UTSW 4 106607300 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCATAGGGGCCACGATTACC -3'
(R):5'- TCTTCCTCAGATGAACCAGAAC -3'

Sequencing Primer
(F):5'- CCAGTGGACTTTTTCACAAAGGTC -3'
(R):5'- CCAGAACAAAGACTGGGACTGAC -3'
Posted On 2020-06-30