Incidental Mutation 'R8118:Skint6'
ID 631324
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112804616-113286973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 113156494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 353 (S353R)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: S353R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: S353R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: S353R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: S353R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
meissner UTSW 4 112804694 missense possibly damaging 0.86
Tegmentum UTSW 4 112842822 splice site probably null
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 splice site probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 splice site probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 splice site probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 splice site probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7461:Skint6 UTSW 4 113177046 splice site probably null
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113177046 splice site probably null
R7956:Skint6 UTSW 4 112846697 missense possibly damaging 0.85
R8118:Skint6 UTSW 4 112865675 missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112894843 splice site probably null
R8218:Skint6 UTSW 4 112839274 splice site probably null
R8344:Skint6 UTSW 4 113236445 missense probably damaging 1.00
R8518:Skint6 UTSW 4 113238268 missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113192672 missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112804694 missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112988952 missense probably benign 0.00
R8866:Skint6 UTSW 4 112854453 missense probably benign
R8881:Skint6 UTSW 4 112815519 missense possibly damaging 0.53
R8949:Skint6 UTSW 4 113074099 missense probably benign 0.04
R8967:Skint6 UTSW 4 112872504 nonsense probably null
R9005:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9007:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9053:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9055:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9144:Skint6 UTSW 4 113127905 missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113176976 missense probably damaging 0.98
R9297:Skint6 UTSW 4 112811520 missense probably benign 0.00
R9388:Skint6 UTSW 4 113192641 missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113177027 missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112806840 critical splice donor site probably null
R9515:Skint6 UTSW 4 112858178 missense probably benign
R9572:Skint6 UTSW 4 113127931 missense probably benign
R9689:Skint6 UTSW 4 113236349 missense probably damaging 0.99
R9744:Skint6 UTSW 4 112809163 missense probably damaging 1.00
R9785:Skint6 UTSW 4 112883687 missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 112892014 missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113238294 missense probably damaging 0.96
Z1176:Skint6 UTSW 4 113238295 missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112806928 missense possibly damaging 0.96
Z1177:Skint6 UTSW 4 113105961 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAACTCTTGCTCTTTCACATGTACA -3'
(R):5'- TCTCTAGGGAATGGTTAATCTGGC -3'

Sequencing Primer
(F):5'- TGCTCTTTCACATGTACAAATATGTC -3'
(R):5'- ATTGAGTACCTGGCTAGAGGACTTAC -3'
Posted On 2020-06-30