Incidental Mutation 'R0706:Klk1b5'
ID 63133
Institutional Source Beutler Lab
Gene Symbol Klk1b5
Ensembl Gene ENSMUSG00000066512
Gene Name kallikrein 1-related peptidase b5
Synonyms mGK-5, Klk5
MMRRC Submission 038889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R0706 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 44215945-44220703 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44218514 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 37 (P37S)
Ref Sequence ENSEMBL: ENSMUSP00000073964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074359]
AlphaFold P15945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074359
AA Change: P37S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073964
Gene: ENSMUSG00000066512
AA Change: P37S

DomainStartEndE-ValueType
Tryp_SPc 24 253 1.49e-100 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206890
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef15 C T 11: 68,954,576 R150H probably damaging Het
Btnl2 T A 17: 34,368,662 N493K probably benign Het
Ccdc175 G A 12: 72,139,948 T374I probably benign Het
Dock4 A G 12: 40,702,923 S419G probably damaging Het
Ireb2 A G 9: 54,892,486 T404A probably benign Het
Lrrc32 C T 7: 98,499,710 R566W probably damaging Het
Med12l A G 3: 59,261,980 N1597S probably damaging Het
Mrpl50 T C 4: 49,514,198 S158G probably benign Het
Mycbpap G T 11: 94,513,786 Y110* probably null Het
Nphp4 G A 4: 152,555,617 A987T probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tprn A G 2: 25,264,491 I602V probably damaging Het
Xpo1 T A 11: 23,280,441 V276E probably benign Het
Other mutations in Klk1b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Klk1b5 APN 7 44216504 missense probably benign 0.00
R0515:Klk1b5 UTSW 7 44218533 missense probably damaging 1.00
R1689:Klk1b5 UTSW 7 44220545 missense probably damaging 0.98
R1845:Klk1b5 UTSW 7 44220125 missense probably benign
R2153:Klk1b5 UTSW 7 44219898 critical splice donor site probably null
R8264:Klk1b5 UTSW 7 44220030 missense probably damaging 1.00
R8402:Klk1b5 UTSW 7 44218538 missense probably benign 0.01
R8711:Klk1b5 UTSW 7 44218572 missense probably benign 0.02
R8886:Klk1b5 UTSW 7 44219768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTACCCACAGCATAGATCTCCC -3'
(R):5'- CATGGATAGTTTCAGCCAGTCCCAC -3'

Sequencing Primer
(F):5'- ATATATGGGTCCCTTCCCCAG -3'
(R):5'- ACCTGCCTGCCCTTCAG -3'
Posted On 2013-07-30