Incidental Mutation 'R8118:Tex29'
ID 631340
Institutional Source Beutler Lab
Gene Symbol Tex29
Ensembl Gene ENSMUSG00000031512
Gene Name testis expressed 29
Synonyms
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 11840474-11855761 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11854263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 116 (E116D)
Ref Sequence ENSEMBL: ENSMUSP00000033909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033909] [ENSMUST00000166638] [ENSMUST00000209692] [ENSMUST00000209704]
AlphaFold Q9DA77
Predicted Effect unknown
Transcript: ENSMUST00000033909
AA Change: E116D
SMART Domains Protein: ENSMUSP00000033909
Gene: ENSMUSG00000031512
AA Change: E116D

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 105 132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166638
AA Change: E116D
SMART Domains Protein: ENSMUSP00000132090
Gene: ENSMUSG00000031512
AA Change: E116D

DomainStartEndE-ValueType
Pfam:TEX29 13 88 9.6e-47 PFAM
low complexity region 105 132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209692
AA Change: E134D
Predicted Effect probably benign
Transcript: ENSMUST00000209704
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 (GRCm38) D792G probably damaging Het
Adcy7 A G 8: 88,315,756 (GRCm38) H417R probably damaging Het
Agr2 A G 12: 35,996,107 (GRCm38) D79G probably benign Het
Ankle1 T C 8: 71,407,635 (GRCm38) S286P probably benign Het
Arhgef11 T C 3: 87,735,857 (GRCm38) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 (GRCm38) M421T probably damaging Het
Cdk17 C A 10: 93,216,390 (GRCm38) Q111K possibly damaging Het
Cobl A G 11: 12,254,834 (GRCm38) S623P probably benign Het
Dgka C T 10: 128,722,449 (GRCm38) probably null Het
Dsc2 C T 18: 20,032,274 (GRCm38) G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 (GRCm38) I267V probably benign Het
Exoc4 T C 6: 33,971,918 (GRCm38) Y899H probably damaging Het
Fat3 A G 9: 15,960,104 (GRCm38) F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 (GRCm38) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
Gm7030 C T 17: 36,127,690 (GRCm38) V270M probably damaging Het
Gpr61 A G 3: 108,150,572 (GRCm38) S258P probably damaging Het
Hectd4 C T 5: 121,286,376 (GRCm38) H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 (GRCm38) T154I probably benign Het
Inf2 A T 12: 112,601,437 (GRCm38) H167L probably damaging Het
Ints3 C T 3: 90,400,299 (GRCm38) probably null Het
Ippk C T 13: 49,446,342 (GRCm38) P226S Het
Itgal C A 7: 127,311,245 (GRCm38) Q509K probably benign Het
Klhl20 A T 1: 161,098,401 (GRCm38) probably null Het
Krtap4-13 C T 11: 99,809,398 (GRCm38) C145Y unknown Het
Large1 A G 8: 73,131,944 (GRCm38) S99P probably benign Het
Lexm T A 4: 106,613,398 (GRCm38) R192S possibly damaging Het
Lrba A T 3: 86,354,226 (GRCm38) I1496L probably benign Het
Map2 A T 1: 66,425,391 (GRCm38) I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 (GRCm38) V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 (GRCm38) N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 (GRCm38) L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 (GRCm38) I253V probably benign Het
Mtfp1 A G 11: 4,093,910 (GRCm38) S107P probably damaging Het
Nebl T A 2: 17,379,820 (GRCm38) Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 (GRCm38) D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 (GRCm38) I20L probably benign Het
Nup205 T A 6: 35,230,516 (GRCm38) M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 (GRCm38) N151K probably damaging Het
Olfr304 A T 7: 86,385,768 (GRCm38) C297* probably null Het
Olfr51 A G 11: 51,007,500 (GRCm38) H176R probably damaging Het
Olfr720 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Olfr725 T C 14: 50,035,151 (GRCm38) D84G probably benign Het
Olfr998 T A 2: 85,590,988 (GRCm38) Y149* probably null Het
Palm3 A G 8: 84,029,809 (GRCm38) E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 (GRCm38) L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 (GRCm38) V57F probably damaging Het
Scaf8 T A 17: 3,164,183 (GRCm38) V171D unknown Het
Sf3a2 T C 10: 80,803,640 (GRCm38) Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 (GRCm38) L67R probably damaging Het
Shank2 A T 7: 144,409,875 (GRCm38) I407L probably benign Het
Skint6 A C 4: 113,156,494 (GRCm38) S353R possibly damaging Het
Skint6 T C 4: 112,865,675 (GRCm38) T902A possibly damaging Het
Srrm2 T A 17: 23,808,083 (GRCm38) I87N unknown Het
Stard9 G A 2: 120,704,430 (GRCm38) G3723S probably benign Het
Svs3b A G 2: 164,256,006 (GRCm38) S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 (GRCm38) F412L probably benign Het
Tmem204 T C 17: 25,080,338 (GRCm38) D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 (GRCm38) R308C probably benign Het
Ttn T A 2: 76,747,164 (GRCm38) I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 (GRCm38) E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 (GRCm38) N134S probably damaging Het
Usp31 T C 7: 121,677,262 (GRCm38) T351A probably damaging Het
Usp33 T C 3: 152,360,359 (GRCm38) L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 (GRCm38) I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 (GRCm38) P1193L Het
Wnk2 A G 13: 49,090,983 (GRCm38) V459A probably damaging Het
Other mutations in Tex29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Tex29 APN 8 11,844,231 (GRCm38) nonsense probably null
R0562:Tex29 UTSW 8 11,844,138 (GRCm38) splice site probably benign
R0830:Tex29 UTSW 8 11,854,157 (GRCm38) missense probably benign 0.35
R4829:Tex29 UTSW 8 11,855,668 (GRCm38) utr 3 prime probably benign
R5723:Tex29 UTSW 8 11,854,279 (GRCm38) utr 3 prime probably benign
R5892:Tex29 UTSW 8 11,854,288 (GRCm38) utr 3 prime probably benign
R5902:Tex29 UTSW 8 11,855,723 (GRCm38) utr 3 prime probably benign
R5902:Tex29 UTSW 8 11,854,277 (GRCm38) utr 3 prime probably benign
R5902:Tex29 UTSW 8 11,854,276 (GRCm38) utr 3 prime probably benign
R7866:Tex29 UTSW 8 11,844,055 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCATGTGGGTCTCATTGC -3'
(R):5'- AACAGTGTTGGCCATTCCTG -3'

Sequencing Primer
(F):5'- CTCATTGCAGAGCCCGTGTATG -3'
(R):5'- ATTCCTGTCAAGGGCCATCAG -3'
Posted On 2020-06-30