Incidental Mutation 'R8118:Large1'
ID 631343
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73131944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000004497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably benign
Transcript: ENSMUST00000004497
AA Change: S99P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: S99P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119826
AA Change: S99P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: S99P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212459
AA Change: S99P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8525:Large1 UTSW 8 72837492 missense probably damaging 1.00
R8963:Large1 UTSW 8 72815984 missense probably damaging 1.00
R9170:Large1 UTSW 8 72816017 missense probably benign 0.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGGAAGTAGGATATCATTTGAGATG -3'
(R):5'- TCTCCTCCTCTAGATGGGAAAC -3'

Sequencing Primer
(F):5'- ACCTCACACTTTTCCACAG -3'
(R):5'- GGAAACCTGTGTCTCTGTCTC -3'
Posted On 2020-06-30