Incidental Mutation 'R8118:Sf3a2'
ID631347
Institutional Source Beutler Lab
Gene Symbol Sf3a2
Ensembl Gene ENSMUSG00000020211
Gene Namesplicing factor 3a, subunit 2
SynonymsSFA66, Sap62, PRP11, 66kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80798198-80804924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80803640 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 155 (Y155H)
Ref Sequence ENSEMBL: ENSMUSP00000117160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020435] [ENSMUST00000036016] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000151928] [ENSMUST00000181039] [ENSMUST00000181945]
Predicted Effect probably benign
Transcript: ENSMUST00000020435
SMART Domains Protein: ENSMUSP00000020435
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 52 77 N/A INTRINSIC
Pfam:JSRP 79 138 1e-29 PFAM
low complexity region 145 158 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036016
SMART Domains Protein: ENSMUSP00000043153
Gene: ENSMUSG00000035262

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:AMH_N 75 439 3e-133 PFAM
TGFB 456 554 8.57e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148665
AA Change: Y155H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211
AA Change: Y155H

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151928
AA Change: Y155H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211
AA Change: Y155H

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181039
SMART Domains Protein: ENSMUSP00000137666
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 92 117 N/A INTRINSIC
Pfam:JSRP 118 179 1e-31 PFAM
low complexity region 185 198 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 245 270 N/A INTRINSIC
low complexity region 313 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181945
SMART Domains Protein: ENSMUSP00000137960
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Sf3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Sf3a2 APN 10 80804692 nonsense probably null
IGL02997:Sf3a2 APN 10 80803620 missense probably damaging 1.00
R0470:Sf3a2 UTSW 10 80804554 unclassified probably benign
R1436:Sf3a2 UTSW 10 80804206 unclassified probably benign
R1437:Sf3a2 UTSW 10 80804206 unclassified probably benign
R2233:Sf3a2 UTSW 10 80802829 missense probably benign 0.05
R2234:Sf3a2 UTSW 10 80802829 missense probably benign 0.05
R3871:Sf3a2 UTSW 10 80804693 unclassified probably benign
R4116:Sf3a2 UTSW 10 80801341 missense probably damaging 0.98
R4659:Sf3a2 UTSW 10 80803584 missense probably damaging 1.00
R4946:Sf3a2 UTSW 10 80804113 unclassified probably benign
R5081:Sf3a2 UTSW 10 80804441 unclassified probably benign
R5618:Sf3a2 UTSW 10 80804576 unclassified probably benign
R6039:Sf3a2 UTSW 10 80801463 missense probably damaging 1.00
R6039:Sf3a2 UTSW 10 80801463 missense probably damaging 1.00
R7925:Sf3a2 UTSW 10 80804437 unclassified probably benign
R7930:Sf3a2 UTSW 10 80804437 unclassified probably benign
R8170:Sf3a2 UTSW 10 80803297 splice site probably null
R8757:Sf3a2 UTSW 10 80804304 missense unknown
R8785:Sf3a2 UTSW 10 80804437 unclassified probably benign
R8874:Sf3a2 UTSW 10 80804437 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGCAGTGACCAAGCAGAG -3'
(R):5'- CAAAACTTGCCCTCAGCCTTG -3'

Sequencing Primer
(F):5'- TGACCAAGCAGAGGGACAC -3'
(R):5'- CTTGGCACCTAGGGAGAAAGTC -3'
Posted On2020-06-30