Incidental Mutation 'R8118:Rgs7bp'
ID631361
Institutional Source Beutler Lab
Gene Symbol Rgs7bp
Ensembl Gene ENSMUSG00000021719
Gene Nameregulator of G-protein signalling 7 binding protein
SynonymsD13Bwg1146e, R7bp, A930030I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location104945904-105054930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105053121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 57 (V57F)
Ref Sequence ENSEMBL: ENSMUSP00000066614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063551]
Predicted Effect probably damaging
Transcript: ENSMUST00000063551
AA Change: V57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066614
Gene: ENSMUSG00000021719
AA Change: V57F

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
coiled coil region 194 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to all members of the R7 subfamily of regulators of G protein signaling and regulates their translocation between the nucleus and the plasma membrane. The encoded protein could be regulated by reversible palmitoylation, which anchors it to the plasma membrane. Depalmitoylation localizes the protein to the nucleus. Polymorphisms in this gene may be associated with risk of aspirin-exacerbated respiratory disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit normal behavior and brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Rgs7bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rgs7bp APN 13 104951579 missense possibly damaging 0.92
R0607:Rgs7bp UTSW 13 104967102 missense probably benign 0.02
R1938:Rgs7bp UTSW 13 104951582 missense probably damaging 1.00
R2151:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R3932:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R3933:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R4686:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R4828:Rgs7bp UTSW 13 105053024 missense possibly damaging 0.59
R4944:Rgs7bp UTSW 13 104951564 missense probably benign 0.29
R7181:Rgs7bp UTSW 13 104982874 missense possibly damaging 0.85
R7786:Rgs7bp UTSW 13 105054060 missense probably benign 0.01
R8190:Rgs7bp UTSW 13 105053109 missense probably damaging 1.00
R8481:Rgs7bp UTSW 13 105054208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCAGCATCCACACATC -3'
(R):5'- GCCTTGGATAAAGAGACTTTGC -3'

Sequencing Primer
(F):5'- TAAAGTCAAAAGTCTCCTACCCTGAG -3'
(R):5'- CCTTGGATAAAGAGACTTTGCCATCC -3'
Posted On2020-06-30