Incidental Mutation 'R8118:Olfr720'
ID631363
Institutional Source Beutler Lab
Gene Symbol Olfr720
Ensembl Gene ENSMUSG00000052417
Gene Nameolfactory receptor 720
SynonymsMOR274-2, GA_x6K02T2PLTE-6544896-6543946
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location14171738-14186838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14175863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 73 (I73T)
Ref Sequence ENSEMBL: ENSMUSP00000146132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035250] [ENSMUST00000206298] [ENSMUST00000216079] [ENSMUST00000217642]
Predicted Effect probably damaging
Transcript: ENSMUST00000035250
AA Change: I73T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046509
Gene: ENSMUSG00000052417
AA Change: I73T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.4e-49 PFAM
Pfam:7tm_1 40 289 8.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206298
AA Change: I73T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216079
AA Change: I73T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217642
AA Change: I73T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Olfr720
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02658:Olfr720 APN 14 14175732 missense possibly damaging 0.92
IGL02704:Olfr720 APN 14 14175483 missense probably benign 0.00
IGL03308:Olfr720 APN 14 14175161 missense probably benign
IGL03331:Olfr720 APN 14 14176017 missense probably benign 0.16
R0008:Olfr720 UTSW 14 14176092 start gained probably benign
R0131:Olfr720 UTSW 14 14175620 missense probably benign 0.03
R0647:Olfr720 UTSW 14 14175858 missense probably benign 0.35
R0747:Olfr720 UTSW 14 14175429 missense probably benign 0.01
R1210:Olfr720 UTSW 14 14176029 missense probably benign 0.00
R1225:Olfr720 UTSW 14 14175600 missense possibly damaging 0.89
R1525:Olfr720 UTSW 14 14175725 missense probably damaging 1.00
R1975:Olfr720 UTSW 14 14175446 missense probably damaging 1.00
R1994:Olfr720 UTSW 14 14175854 missense probably benign 0.16
R2310:Olfr720 UTSW 14 14175836 missense probably benign 0.03
R3151:Olfr720 UTSW 14 14175203 missense probably damaging 1.00
R4547:Olfr720 UTSW 14 14175854 missense probably damaging 0.99
R4824:Olfr720 UTSW 14 14175885 missense probably damaging 1.00
R5063:Olfr720 UTSW 14 14175593 missense probably damaging 1.00
R5098:Olfr720 UTSW 14 14175683 missense probably benign 0.03
R5430:Olfr720 UTSW 14 14175692 missense probably benign 0.03
R5512:Olfr720 UTSW 14 14175633 missense probably damaging 1.00
R5748:Olfr720 UTSW 14 14175314 missense probably damaging 1.00
R7200:Olfr720 UTSW 14 14175477 missense probably damaging 1.00
R7407:Olfr720 UTSW 14 14175402 missense probably benign
R7666:Olfr720 UTSW 14 14176075 missense probably benign
R7760:Olfr720 UTSW 14 14175905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACTCATGAGGACAGGATAAC -3'
(R):5'- GGAAACAAAACCTTTCCCAGTG -3'

Sequencing Primer
(F):5'- CGGAGCGGATTACAGATGGC -3'
(R):5'- TGACTTCACCTTTGTGGGAC -3'
Posted On2020-06-30