Incidental Mutation 'R8118:Wdfy4'
ID631364
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33104115 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1193 (P1193L)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect probably damaging
Transcript: ENSMUST00000061753
AA Change: P1148L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: P1148L

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: P1193L

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.6747 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
dodgers UTSW 14 32977106 nonsense probably null
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
gigantea UTSW 14 32974154 critical splice donor site probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7946:Wdfy4 UTSW 14 33070748 missense
R7946:Wdfy4 UTSW 14 33104115 missense
R7986:Wdfy4 UTSW 14 33104115 missense
R7990:Wdfy4 UTSW 14 33097795 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
R8090:Wdfy4 UTSW 14 33104115 missense
R8092:Wdfy4 UTSW 14 33104115 missense
R8112:Wdfy4 UTSW 14 33104115 missense
R8114:Wdfy4 UTSW 14 33104115 missense
R8115:Wdfy4 UTSW 14 33104115 missense
R8117:Wdfy4 UTSW 14 32977106 nonsense probably null
R8117:Wdfy4 UTSW 14 33104115 missense
R8140:Wdfy4 UTSW 14 33142360 missense
R8155:Wdfy4 UTSW 14 33162819 missense
R8163:Wdfy4 UTSW 14 33151588 missense
R8293:Wdfy4 UTSW 14 32974261 missense
R8325:Wdfy4 UTSW 14 32967487 missense
R8353:Wdfy4 UTSW 14 32973624 missense probably benign
R8370:Wdfy4 UTSW 14 33093251 missense
R8437:Wdfy4 UTSW 14 33076375 missense
R8497:Wdfy4 UTSW 14 32966399 missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 33078301 missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32971765 splice site probably benign
R8708:Wdfy4 UTSW 14 32967532 missense
R8747:Wdfy4 UTSW 14 33152654 missense
R8794:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R8846:Wdfy4 UTSW 14 33145148 missense
R8880:Wdfy4 UTSW 14 33073535 nonsense probably null
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- CGGGCCGAGTTTGATAATAAGTG -3'
(R):5'- TGAGCTGTTGCCTTCATAGG -3'

Sequencing Primer
(F):5'- ATAAGTGCTAGAGTATCCGCTG -3'
(R):5'- AGGATCTGCTAATTAATCGTTTGCCC -3'
Posted On2020-06-30