Incidental Mutation 'R8118:Wdfy4'
ID 631364
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene Name WD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 32959547-33185508 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33104115 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1193 (P1193L)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061753
AA Change: P1148L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: P1148L

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: P1193L

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.6747 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 (GRCm38) D792G probably damaging Het
Adcy7 A G 8: 88,315,756 (GRCm38) H417R probably damaging Het
Agr2 A G 12: 35,996,107 (GRCm38) D79G probably benign Het
Ankle1 T C 8: 71,407,635 (GRCm38) S286P probably benign Het
Arhgef11 T C 3: 87,735,857 (GRCm38) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 (GRCm38) M421T probably damaging Het
Cdk17 C A 10: 93,216,390 (GRCm38) Q111K possibly damaging Het
Cobl A G 11: 12,254,834 (GRCm38) S623P probably benign Het
Dgka C T 10: 128,722,449 (GRCm38) probably null Het
Dsc2 C T 18: 20,032,274 (GRCm38) G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 (GRCm38) I267V probably benign Het
Exoc4 T C 6: 33,971,918 (GRCm38) Y899H probably damaging Het
Fat3 A G 9: 15,960,104 (GRCm38) F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 (GRCm38) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
Gm7030 C T 17: 36,127,690 (GRCm38) V270M probably damaging Het
Gpr61 A G 3: 108,150,572 (GRCm38) S258P probably damaging Het
Hectd4 C T 5: 121,286,376 (GRCm38) H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 (GRCm38) T154I probably benign Het
Inf2 A T 12: 112,601,437 (GRCm38) H167L probably damaging Het
Ints3 C T 3: 90,400,299 (GRCm38) probably null Het
Ippk C T 13: 49,446,342 (GRCm38) P226S Het
Itgal C A 7: 127,311,245 (GRCm38) Q509K probably benign Het
Klhl20 A T 1: 161,098,401 (GRCm38) probably null Het
Krtap4-13 C T 11: 99,809,398 (GRCm38) C145Y unknown Het
Large1 A G 8: 73,131,944 (GRCm38) S99P probably benign Het
Lexm T A 4: 106,613,398 (GRCm38) R192S possibly damaging Het
Lrba A T 3: 86,354,226 (GRCm38) I1496L probably benign Het
Map2 A T 1: 66,425,391 (GRCm38) I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 (GRCm38) V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 (GRCm38) N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 (GRCm38) L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 (GRCm38) I253V probably benign Het
Mtfp1 A G 11: 4,093,910 (GRCm38) S107P probably damaging Het
Nebl T A 2: 17,379,820 (GRCm38) Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 (GRCm38) D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 (GRCm38) I20L probably benign Het
Nup205 T A 6: 35,230,516 (GRCm38) M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 (GRCm38) N151K probably damaging Het
Olfr304 A T 7: 86,385,768 (GRCm38) C297* probably null Het
Olfr51 A G 11: 51,007,500 (GRCm38) H176R probably damaging Het
Olfr720 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Olfr725 T C 14: 50,035,151 (GRCm38) D84G probably benign Het
Olfr998 T A 2: 85,590,988 (GRCm38) Y149* probably null Het
Palm3 A G 8: 84,029,809 (GRCm38) E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 (GRCm38) L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 (GRCm38) V57F probably damaging Het
Scaf8 T A 17: 3,164,183 (GRCm38) V171D unknown Het
Sf3a2 T C 10: 80,803,640 (GRCm38) Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 (GRCm38) L67R probably damaging Het
Shank2 A T 7: 144,409,875 (GRCm38) I407L probably benign Het
Skint6 A C 4: 113,156,494 (GRCm38) S353R possibly damaging Het
Skint6 T C 4: 112,865,675 (GRCm38) T902A possibly damaging Het
Srrm2 T A 17: 23,808,083 (GRCm38) I87N unknown Het
Stard9 G A 2: 120,704,430 (GRCm38) G3723S probably benign Het
Svs3b A G 2: 164,256,006 (GRCm38) S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 (GRCm38) F412L probably benign Het
Tex29 A T 8: 11,854,263 (GRCm38) E116D unknown Het
Tmem204 T C 17: 25,080,338 (GRCm38) D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 (GRCm38) R308C probably benign Het
Ttn T A 2: 76,747,164 (GRCm38) I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 (GRCm38) E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 (GRCm38) N134S probably damaging Het
Usp31 T C 7: 121,677,262 (GRCm38) T351A probably damaging Het
Usp33 T C 3: 152,360,359 (GRCm38) L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 (GRCm38) I471N probably damaging Het
Wnk2 A G 13: 49,090,983 (GRCm38) V459A probably damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33,102,539 (GRCm38) missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32,959,977 (GRCm38) missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33,104,037 (GRCm38) missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33,151,661 (GRCm38) missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33,020,238 (GRCm38) splice site probably benign
IGL01931:Wdfy4 APN 14 33,155,753 (GRCm38) missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33,133,716 (GRCm38) missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33,076,480 (GRCm38) missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33,093,300 (GRCm38) missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33,149,566 (GRCm38) missense probably benign
IGL02468:Wdfy4 APN 14 32,966,432 (GRCm38) missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33,042,491 (GRCm38) missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33,090,861 (GRCm38) nonsense probably null
IGL02752:Wdfy4 APN 14 33,076,326 (GRCm38) missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33,095,305 (GRCm38) missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32,971,750 (GRCm38) missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33,109,650 (GRCm38) missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33,076,284 (GRCm38) missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33,140,651 (GRCm38) missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32,966,435 (GRCm38) missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33,162,870 (GRCm38) missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33,125,887 (GRCm38) missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32,977,167 (GRCm38) missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33,068,904 (GRCm38) missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33,047,290 (GRCm38) missense probably benign 0.14
dodgers UTSW 14 32,977,106 (GRCm38) nonsense probably null
Dollar UTSW 14 33,020,311 (GRCm38) missense probably damaging 1.00
Giants UTSW 14 33,070,618 (GRCm38) nonsense probably null
gigantea UTSW 14 32,974,154 (GRCm38) critical splice donor site probably null
kings_canyon UTSW 14 33,109,519 (GRCm38) nonsense probably null
moro UTSW 14 32,964,626 (GRCm38) splice site probably null
popped UTSW 14 32,966,399 (GRCm38) missense probably damaging 0.99
sequoia UTSW 14 33,100,903 (GRCm38) critical splice donor site probably null
Sherman UTSW 14 33,095,951 (GRCm38) missense possibly damaging 0.89
stretched UTSW 14 33,073,535 (GRCm38) nonsense probably null
watchtower UTSW 14 33,083,639 (GRCm38) critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33,107,173 (GRCm38) missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33,162,751 (GRCm38) missense probably null 1.00
R0085:Wdfy4 UTSW 14 33,078,243 (GRCm38) missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33,083,785 (GRCm38) missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33,083,812 (GRCm38) splice site probably benign
R0496:Wdfy4 UTSW 14 33,140,738 (GRCm38) splice site probably benign
R0514:Wdfy4 UTSW 14 33,080,775 (GRCm38) missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33,042,621 (GRCm38) missense probably benign
R0590:Wdfy4 UTSW 14 33,041,174 (GRCm38) missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33,109,699 (GRCm38) missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33,140,612 (GRCm38) missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33,147,092 (GRCm38) missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33,079,966 (GRCm38) missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32,971,738 (GRCm38) missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32,971,772 (GRCm38) splice site probably null
R1415:Wdfy4 UTSW 14 33,041,180 (GRCm38) missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33,108,688 (GRCm38) missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33,100,966 (GRCm38) missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33,152,538 (GRCm38) critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32,960,808 (GRCm38) missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33,042,512 (GRCm38) missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32,959,961 (GRCm38) missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33,073,585 (GRCm38) critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33,096,005 (GRCm38) missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33,103,983 (GRCm38) missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33,133,344 (GRCm38) missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32,971,684 (GRCm38) missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33,106,044 (GRCm38) missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33,146,989 (GRCm38) missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33,073,511 (GRCm38) missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33,162,807 (GRCm38) missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33,109,519 (GRCm38) nonsense probably null
R2889:Wdfy4 UTSW 14 33,109,519 (GRCm38) nonsense probably null
R3114:Wdfy4 UTSW 14 33,089,903 (GRCm38) missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33,023,374 (GRCm38) missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33,023,374 (GRCm38) missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33,140,645 (GRCm38) missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33,047,280 (GRCm38) missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33,047,280 (GRCm38) missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32,966,395 (GRCm38) missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33,102,680 (GRCm38) splice site probably benign
R4091:Wdfy4 UTSW 14 33,125,880 (GRCm38) missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33,096,083 (GRCm38) missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33,087,955 (GRCm38) missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33,102,558 (GRCm38) missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33,102,558 (GRCm38) missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32,989,936 (GRCm38) missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33,109,548 (GRCm38) missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33,145,316 (GRCm38) missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33,100,903 (GRCm38) critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32,988,895 (GRCm38) nonsense probably null
R4894:Wdfy4 UTSW 14 33,155,760 (GRCm38) missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33,047,256 (GRCm38) missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33,029,013 (GRCm38) missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33,100,940 (GRCm38) missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33,079,935 (GRCm38) missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33,152,670 (GRCm38) missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33,047,275 (GRCm38) missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33,078,343 (GRCm38) missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33,090,866 (GRCm38) missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32,988,899 (GRCm38) missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32,960,002 (GRCm38) missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33,020,311 (GRCm38) missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33,151,732 (GRCm38) missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33,107,130 (GRCm38) missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33,133,497 (GRCm38) missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33,107,618 (GRCm38) splice site probably null
R5890:Wdfy4 UTSW 14 33,102,577 (GRCm38) missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33,133,360 (GRCm38) missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33,106,011 (GRCm38) missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33,146,990 (GRCm38) missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33,146,990 (GRCm38) missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33,083,639 (GRCm38) critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32,971,711 (GRCm38) missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33,109,525 (GRCm38) missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33,101,049 (GRCm38) nonsense probably null
R6370:Wdfy4 UTSW 14 33,068,850 (GRCm38) missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33,104,094 (GRCm38) missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32,967,647 (GRCm38) missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33,108,692 (GRCm38) missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33,146,944 (GRCm38) missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33,047,251 (GRCm38) missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33,095,951 (GRCm38) missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33,042,512 (GRCm38) missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32,959,966 (GRCm38) missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33,099,117 (GRCm38) missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32,964,626 (GRCm38) splice site probably null
R7101:Wdfy4 UTSW 14 32,960,820 (GRCm38) missense
R7114:Wdfy4 UTSW 14 32,971,574 (GRCm38) splice site probably null
R7139:Wdfy4 UTSW 14 33,151,578 (GRCm38) missense
R7255:Wdfy4 UTSW 14 32,974,282 (GRCm38) missense
R7324:Wdfy4 UTSW 14 33,047,314 (GRCm38) missense
R7379:Wdfy4 UTSW 14 33,151,609 (GRCm38) missense
R7399:Wdfy4 UTSW 14 33,068,906 (GRCm38) missense
R7408:Wdfy4 UTSW 14 33,078,307 (GRCm38) missense
R7410:Wdfy4 UTSW 14 32,974,234 (GRCm38) missense
R7411:Wdfy4 UTSW 14 33,106,131 (GRCm38) missense
R7412:Wdfy4 UTSW 14 33,149,584 (GRCm38) missense
R7445:Wdfy4 UTSW 14 33,070,618 (GRCm38) nonsense probably null
R7595:Wdfy4 UTSW 14 32,974,154 (GRCm38) critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32,985,739 (GRCm38) missense
R7622:Wdfy4 UTSW 14 33,078,274 (GRCm38) missense
R7828:Wdfy4 UTSW 14 32,988,921 (GRCm38) missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33,090,963 (GRCm38) missense
R7946:Wdfy4 UTSW 14 33,070,748 (GRCm38) missense
R7946:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R7986:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R7990:Wdfy4 UTSW 14 33,097,795 (GRCm38) missense
R8001:Wdfy4 UTSW 14 32,973,535 (GRCm38) critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32,971,627 (GRCm38) missense
R8015:Wdfy4 UTSW 14 33,107,747 (GRCm38) missense
R8032:Wdfy4 UTSW 14 33,029,086 (GRCm38) nonsense probably null
R8041:Wdfy4 UTSW 14 33,154,008 (GRCm38) critical splice donor site probably null
R8090:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R8092:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R8112:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R8114:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R8115:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R8117:Wdfy4 UTSW 14 33,104,115 (GRCm38) missense
R8117:Wdfy4 UTSW 14 32,977,106 (GRCm38) nonsense probably null
R8140:Wdfy4 UTSW 14 33,142,360 (GRCm38) missense
R8155:Wdfy4 UTSW 14 33,162,819 (GRCm38) missense
R8163:Wdfy4 UTSW 14 33,151,588 (GRCm38) missense
R8293:Wdfy4 UTSW 14 32,974,261 (GRCm38) missense
R8325:Wdfy4 UTSW 14 32,967,487 (GRCm38) missense
R8353:Wdfy4 UTSW 14 32,973,624 (GRCm38) missense probably benign
R8370:Wdfy4 UTSW 14 33,093,251 (GRCm38) missense
R8437:Wdfy4 UTSW 14 33,076,375 (GRCm38) missense
R8497:Wdfy4 UTSW 14 32,966,399 (GRCm38) missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 33,078,301 (GRCm38) missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32,971,765 (GRCm38) splice site probably benign
R8708:Wdfy4 UTSW 14 32,967,532 (GRCm38) missense
R8747:Wdfy4 UTSW 14 33,152,654 (GRCm38) missense
R8794:Wdfy4 UTSW 14 33,147,092 (GRCm38) missense probably benign 0.03
R8846:Wdfy4 UTSW 14 33,145,148 (GRCm38) missense
R8880:Wdfy4 UTSW 14 33,073,535 (GRCm38) nonsense probably null
R9109:Wdfy4 UTSW 14 33,038,747 (GRCm38) splice site probably null
R9131:Wdfy4 UTSW 14 33,097,850 (GRCm38) missense
R9309:Wdfy4 UTSW 14 33,095,356 (GRCm38) missense
R9349:Wdfy4 UTSW 14 33,154,039 (GRCm38) missense
R9451:Wdfy4 UTSW 14 33,133,561 (GRCm38) missense
R9563:Wdfy4 UTSW 14 32,970,876 (GRCm38) missense
R9587:Wdfy4 UTSW 14 33,047,273 (GRCm38) nonsense probably null
R9599:Wdfy4 UTSW 14 33,133,471 (GRCm38) missense
R9670:Wdfy4 UTSW 14 33,047,262 (GRCm38) missense
R9718:Wdfy4 UTSW 14 33,125,936 (GRCm38) missense
R9742:Wdfy4 UTSW 14 33,088,030 (GRCm38) missense
X0028:Wdfy4 UTSW 14 33,080,636 (GRCm38) missense probably benign
X0053:Wdfy4 UTSW 14 33,162,942 (GRCm38) start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33,107,618 (GRCm38) splice site probably null
Z1177:Wdfy4 UTSW 14 33,087,985 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- CGGGCCGAGTTTGATAATAAGTG -3'
(R):5'- TGAGCTGTTGCCTTCATAGG -3'

Sequencing Primer
(F):5'- ATAAGTGCTAGAGTATCCGCTG -3'
(R):5'- AGGATCTGCTAATTAATCGTTTGCCC -3'
Posted On 2020-06-30