Incidental Mutation 'R8118:Olfr725'
ID631365
Institutional Source Beutler Lab
Gene Symbol Olfr725
Ensembl Gene ENSMUSG00000068437
Gene Nameolfactory receptor 725
SynonymsMOR246-3, GA_x6K02T2PMLR-5725741-5724776, MOR246-7_p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50034314-50040375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50035151 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000145828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089844] [ENSMUST00000206920]
Predicted Effect probably benign
Transcript: ENSMUST00000089844
AA Change: D84G

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087282
Gene: ENSMUSG00000068437
AA Change: D84G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 36 282 1.8e-7 PFAM
Pfam:7tm_1 41 287 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206920
AA Change: D84G

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,795,933 D792G probably damaging Het
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Olfr725
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Olfr725 APN 14 50035050 missense probably benign 0.29
IGL01412:Olfr725 APN 14 50035313 missense probably benign
IGL03241:Olfr725 APN 14 50035068 missense possibly damaging 0.70
IGL03268:Olfr725 APN 14 50034567 missense probably damaging 0.98
IGL03348:Olfr725 APN 14 50034755 missense probably benign 0.00
R0358:Olfr725 UTSW 14 50035286 missense probably damaging 0.97
R0577:Olfr725 UTSW 14 50034792 missense probably damaging 1.00
R2094:Olfr725 UTSW 14 50034714 missense probably damaging 1.00
R2424:Olfr725 UTSW 14 50034824 missense probably damaging 1.00
R3421:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R3422:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R4436:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4437:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4438:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4684:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4717:Olfr725 UTSW 14 50035364 missense probably damaging 0.98
R5253:Olfr725 UTSW 14 50035288 missense possibly damaging 0.91
R5254:Olfr725 UTSW 14 50034678 missense possibly damaging 0.60
R5641:Olfr725 UTSW 14 50035289 missense probably benign 0.04
R5881:Olfr725 UTSW 14 50034987 missense probably benign 0.00
R5906:Olfr725 UTSW 14 50034849 missense probably benign 0.05
R6511:Olfr725 UTSW 14 50034809 missense probably damaging 1.00
R7837:Olfr725 UTSW 14 50034576 missense probably damaging 1.00
R7980:Olfr725 UTSW 14 50034795 missense probably damaging 1.00
X0062:Olfr725 UTSW 14 50034860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACCAGGGGATGATGACC -3'
(R):5'- TCTAGTTCAAAGGAGCTCCAGC -3'

Sequencing Primer
(F):5'- GGATGATGACCAGAGTGATACAC -3'
(R):5'- AAAGGAGCTCCAGCCTTTCCTG -3'
Posted On2020-06-30