Incidental Mutation 'R8118:Nlrc3'
ID 631366
Institutional Source Beutler Lab
Gene Symbol Nlrc3
Ensembl Gene ENSMUSG00000049871
Gene Name NLR family, CARD domain containing 3
Synonyms CLR16.2, D230007K08Rik, Caterpiller 16.2
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 3762871-3794496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3783495 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 20 (I20L)
Ref Sequence ENSEMBL: ENSMUSP00000137628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177551
AA Change: I20L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: I20L

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229884
AA Change: I4L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,592,821 (GRCm39) D792G probably damaging Het
Adcy7 A G 8: 89,042,384 (GRCm39) H417R probably damaging Het
Agr2 A G 12: 36,046,106 (GRCm39) D79G probably benign Het
Ankle1 T C 8: 71,860,279 (GRCm39) S286P probably benign Het
Arhgef11 T C 3: 87,643,164 (GRCm39) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,789,837 (GRCm39) M421T probably damaging Het
Cdk17 C A 10: 93,052,252 (GRCm39) Q111K possibly damaging Het
Cimap2 T A 4: 106,470,595 (GRCm39) R192S possibly damaging Het
Cobl A G 11: 12,204,834 (GRCm39) S623P probably benign Het
Dgka C T 10: 128,558,318 (GRCm39) probably null Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Dsg2 A G 18: 20,715,858 (GRCm39) I267V probably benign Het
Exoc4 T C 6: 33,948,853 (GRCm39) Y899H probably damaging Het
Fat3 A G 9: 15,871,400 (GRCm39) F3664L probably benign Het
Fbxo47 C T 11: 97,770,341 (GRCm39) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
Gpr61 A G 3: 108,057,888 (GRCm39) S258P probably damaging Het
H2-T9 C T 17: 36,438,582 (GRCm39) V270M probably damaging Het
Hectd4 C T 5: 121,424,439 (GRCm39) H700Y probably benign Het
Hs3st2 C T 7: 120,996,651 (GRCm39) T154I probably benign Het
Inf2 A T 12: 112,567,871 (GRCm39) H167L probably damaging Het
Ints3 C T 3: 90,307,606 (GRCm39) probably null Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Itgal C A 7: 126,910,417 (GRCm39) Q509K probably benign Het
Klhl20 A T 1: 160,925,971 (GRCm39) probably null Het
Krtap4-13 C T 11: 99,700,224 (GRCm39) C145Y unknown Het
Large1 A G 8: 73,858,572 (GRCm39) S99P probably benign Het
Lrba A T 3: 86,261,533 (GRCm39) I1496L probably benign Het
Map2 A T 1: 66,464,550 (GRCm39) I1647F probably damaging Het
Map3k10 A G 7: 27,372,842 (GRCm39) V203A possibly damaging Het
Mcmdc2 T A 1: 9,986,599 (GRCm39) N166K possibly damaging Het
Mlxipl T G 5: 135,166,102 (GRCm39) L828R possibly damaging Het
Mnat1 A G 12: 73,265,864 (GRCm39) I253V probably benign Het
Mtfp1 A G 11: 4,043,910 (GRCm39) S107P probably damaging Het
Nebl T A 2: 17,384,631 (GRCm39) Y65F possibly damaging Het
Nelfb A T 2: 25,095,171 (GRCm39) D339E possibly damaging Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or14a258 A T 7: 86,034,976 (GRCm39) C297* probably null Het
Or1ad8 A G 11: 50,898,327 (GRCm39) H176R probably damaging Het
Or2t6 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Or4k15b T C 14: 50,272,608 (GRCm39) D84G probably benign Het
Or5b123 T A 19: 13,597,109 (GRCm39) N151K probably damaging Het
Or5g29 T A 2: 85,421,332 (GRCm39) Y149* probably null Het
Palm3 A G 8: 84,756,438 (GRCm39) E650G probably damaging Het
Prps1l1 C A 12: 35,035,340 (GRCm39) L152M probably damaging Het
Rgs7bp C A 13: 105,189,629 (GRCm39) V57F probably damaging Het
Scaf8 T A 17: 3,214,458 (GRCm39) V171D unknown Het
Sf3a2 T C 10: 80,639,474 (GRCm39) Y155H probably damaging Het
Sfrp1 T G 8: 23,902,000 (GRCm39) L67R probably damaging Het
Shank2 A T 7: 143,963,612 (GRCm39) I407L probably benign Het
Skint6 T C 4: 112,722,872 (GRCm39) T902A possibly damaging Het
Skint6 A C 4: 113,013,691 (GRCm39) S353R possibly damaging Het
Srrm2 T A 17: 24,027,057 (GRCm39) I87N unknown Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svs3b A G 2: 164,097,926 (GRCm39) S132P probably damaging Het
Tbc1d17 G T 7: 44,492,426 (GRCm39) F412L probably benign Het
Tex29 A T 8: 11,904,263 (GRCm39) E116D unknown Het
Tmem204 T C 17: 25,299,312 (GRCm39) D69G possibly damaging Het
Ttll10 G A 4: 156,129,219 (GRCm39) R308C probably benign Het
Ttn T A 2: 76,577,508 (GRCm39) I24462F probably damaging Het
Tubg2 A G 11: 101,052,304 (GRCm39) E411G probably damaging Het
Ugt2b38 T C 5: 87,571,630 (GRCm39) N134S probably damaging Het
Usp31 T C 7: 121,276,485 (GRCm39) T351A probably damaging Het
Usp33 T C 3: 152,065,996 (GRCm39) L92S probably damaging Het
Vmn2r20 A T 6: 123,373,429 (GRCm39) I471N probably damaging Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wnk2 A G 13: 49,244,459 (GRCm39) V459A probably damaging Het
Other mutations in Nlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nlrc3 APN 16 3,773,030 (GRCm39) missense probably damaging 1.00
IGL00943:Nlrc3 APN 16 3,782,981 (GRCm39) missense possibly damaging 0.94
IGL01481:Nlrc3 APN 16 3,781,769 (GRCm39) missense probably damaging 1.00
IGL01517:Nlrc3 APN 16 3,765,351 (GRCm39) missense probably damaging 0.99
IGL01988:Nlrc3 APN 16 3,771,803 (GRCm39) missense probably benign 0.43
IGL02306:Nlrc3 APN 16 3,782,688 (GRCm39) missense probably damaging 1.00
IGL02515:Nlrc3 APN 16 3,767,323 (GRCm39) splice site probably benign
IGL02795:Nlrc3 APN 16 3,783,149 (GRCm39) missense probably damaging 0.99
IGL02897:Nlrc3 APN 16 3,781,938 (GRCm39) missense possibly damaging 0.85
IGL02992:Nlrc3 APN 16 3,771,887 (GRCm39) splice site probably benign
IGL03003:Nlrc3 APN 16 3,782,726 (GRCm39) missense probably benign 0.03
IGL03381:Nlrc3 APN 16 3,782,179 (GRCm39) missense probably benign 0.03
R0064:Nlrc3 UTSW 16 3,781,951 (GRCm39) missense possibly damaging 0.82
R0064:Nlrc3 UTSW 16 3,781,951 (GRCm39) missense possibly damaging 0.82
R0122:Nlrc3 UTSW 16 3,776,822 (GRCm39) missense probably damaging 0.98
R0482:Nlrc3 UTSW 16 3,783,056 (GRCm39) missense possibly damaging 0.81
R0601:Nlrc3 UTSW 16 3,766,113 (GRCm39) splice site probably benign
R0622:Nlrc3 UTSW 16 3,771,832 (GRCm39) missense probably benign 0.04
R0675:Nlrc3 UTSW 16 3,766,775 (GRCm39) missense probably benign 0.01
R1595:Nlrc3 UTSW 16 3,783,166 (GRCm39) missense probably benign 0.03
R1597:Nlrc3 UTSW 16 3,781,859 (GRCm39) missense probably damaging 1.00
R2013:Nlrc3 UTSW 16 3,782,974 (GRCm39) missense probably damaging 1.00
R2077:Nlrc3 UTSW 16 3,781,856 (GRCm39) missense probably benign 0.35
R2327:Nlrc3 UTSW 16 3,771,304 (GRCm39) missense probably damaging 1.00
R2872:Nlrc3 UTSW 16 3,775,190 (GRCm39) missense possibly damaging 0.56
R2872:Nlrc3 UTSW 16 3,775,190 (GRCm39) missense possibly damaging 0.56
R3037:Nlrc3 UTSW 16 3,770,272 (GRCm39) missense probably damaging 1.00
R3794:Nlrc3 UTSW 16 3,765,739 (GRCm39) missense probably benign 0.22
R3843:Nlrc3 UTSW 16 3,782,828 (GRCm39) missense probably benign
R4761:Nlrc3 UTSW 16 3,781,514 (GRCm39) missense probably damaging 1.00
R5303:Nlrc3 UTSW 16 3,781,478 (GRCm39) missense probably benign 0.15
R5375:Nlrc3 UTSW 16 3,782,617 (GRCm39) missense possibly damaging 0.95
R5468:Nlrc3 UTSW 16 3,781,899 (GRCm39) missense probably damaging 1.00
R5719:Nlrc3 UTSW 16 3,781,589 (GRCm39) missense probably damaging 1.00
R5838:Nlrc3 UTSW 16 3,771,859 (GRCm39) missense probably damaging 1.00
R5879:Nlrc3 UTSW 16 3,781,909 (GRCm39) missense probably damaging 1.00
R5942:Nlrc3 UTSW 16 3,767,293 (GRCm39) missense probably damaging 1.00
R6500:Nlrc3 UTSW 16 3,770,308 (GRCm39) missense possibly damaging 0.79
R6600:Nlrc3 UTSW 16 3,782,938 (GRCm39) missense probably benign 0.29
R6704:Nlrc3 UTSW 16 3,782,945 (GRCm39) missense probably damaging 0.99
R7172:Nlrc3 UTSW 16 3,781,617 (GRCm39) missense probably benign 0.30
R7283:Nlrc3 UTSW 16 3,765,741 (GRCm39) missense probably benign 0.25
R7296:Nlrc3 UTSW 16 3,781,454 (GRCm39) missense probably damaging 0.99
R7477:Nlrc3 UTSW 16 3,782,675 (GRCm39) missense probably damaging 0.99
R7817:Nlrc3 UTSW 16 3,783,327 (GRCm39) missense possibly damaging 0.87
R8559:Nlrc3 UTSW 16 3,783,146 (GRCm39) missense probably benign 0.05
R8871:Nlrc3 UTSW 16 3,781,968 (GRCm39) intron probably benign
R9008:Nlrc3 UTSW 16 3,776,807 (GRCm39) missense possibly damaging 0.95
R9237:Nlrc3 UTSW 16 3,783,073 (GRCm39) missense probably benign 0.02
R9385:Nlrc3 UTSW 16 3,781,876 (GRCm39) missense probably damaging 1.00
R9430:Nlrc3 UTSW 16 3,783,396 (GRCm39) missense probably benign 0.00
R9509:Nlrc3 UTSW 16 3,782,680 (GRCm39) missense probably damaging 1.00
R9573:Nlrc3 UTSW 16 3,771,841 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTGTCCCGGACTTGTAGCAG -3'
(R):5'- AGACCAACTCTGCATTGTCCC -3'

Sequencing Primer
(F):5'- CGGACTTGTAGCAGCTGAC -3'
(R):5'- CCAAGAGTGTCATCATTGCCAGG -3'
Posted On 2020-06-30