Incidental Mutation 'R8118:Adamts1'
ID631367
Institutional Source Beutler Lab
Gene Symbol Adamts1
Ensembl Gene ENSMUSG00000022893
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
SynonymsMETH1, ADAMTS-1, ADAM-TS1, METH-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8118 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location85793827-85803113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85795933 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 792 (D792G)
Ref Sequence ENSEMBL: ENSMUSP00000023610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]
Predicted Effect probably damaging
Transcript: ENSMUST00000023610
AA Change: D792G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: D792G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 22 194 1.3e-27 PFAM
Pfam:Reprolysin_4 257 464 2.2e-9 PFAM
Pfam:Reprolysin_5 257 466 1.6e-14 PFAM
Pfam:Reprolysin 259 468 3.6e-22 PFAM
Pfam:Reprolysin_2 279 458 2.1e-10 PFAM
Pfam:Reprolysin_3 281 413 4.8e-14 PFAM
ACR 469 549 7.36e-8 SMART
TSP1 563 615 3.77e-14 SMART
Pfam:ADAM_spacer1 726 844 1.7e-35 PFAM
TSP1 858 911 1.22e-8 SMART
TSP1 912 968 1.2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125897
AA Change: D529G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: D529G

DomainStartEndE-ValueType
Pfam:Reprolysin_4 1 201 2.3e-9 PFAM
Pfam:Reprolysin_5 1 203 8.8e-14 PFAM
Pfam:Reprolysin 1 205 5e-22 PFAM
Pfam:Reprolysin_2 16 195 8.6e-10 PFAM
Pfam:Reprolysin_3 19 150 4.2e-14 PFAM
ACR 206 286 7.36e-8 SMART
TSP1 300 352 3.77e-14 SMART
Pfam:ADAM_spacer1 463 581 3e-35 PFAM
TSP1 595 648 1.22e-8 SMART
TSP1 649 680 4.85e-1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,315,756 H417R probably damaging Het
Agr2 A G 12: 35,996,107 D79G probably benign Het
Ankle1 T C 8: 71,407,635 S286P probably benign Het
Arhgef11 T C 3: 87,735,857 S1488P probably damaging Het
Atp6v0a2 T C 5: 124,712,773 M421T probably damaging Het
Cdk17 C A 10: 93,216,390 Q111K possibly damaging Het
Cobl A G 11: 12,254,834 S623P probably benign Het
Dgka C T 10: 128,722,449 probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg2 A G 18: 20,582,801 I267V probably benign Het
Exoc4 T C 6: 33,971,918 Y899H probably damaging Het
Fat3 A G 9: 15,960,104 F3664L probably benign Het
Fbxo47 C T 11: 97,879,515 C17Y probably benign Het
Gm2888 G T 14: 3,037,628 V207F probably benign Het
Gm7030 C T 17: 36,127,690 V270M probably damaging Het
Gpr61 A G 3: 108,150,572 S258P probably damaging Het
Hectd4 C T 5: 121,286,376 H700Y probably benign Het
Hs3st2 C T 7: 121,397,428 T154I probably benign Het
Inf2 A T 12: 112,601,437 H167L probably damaging Het
Ints3 C T 3: 90,400,299 probably null Het
Ippk C T 13: 49,446,342 P226S Het
Itgal C A 7: 127,311,245 Q509K probably benign Het
Klhl20 A T 1: 161,098,401 probably null Het
Krtap4-13 C T 11: 99,809,398 C145Y unknown Het
Large1 A G 8: 73,131,944 S99P probably benign Het
Lexm T A 4: 106,613,398 R192S possibly damaging Het
Lrba A T 3: 86,354,226 I1496L probably benign Het
Map2 A T 1: 66,425,391 I1647F probably damaging Het
Map3k10 A G 7: 27,673,417 V203A possibly damaging Het
Mcmdc2 T A 1: 9,916,374 N166K possibly damaging Het
Mlxipl T G 5: 135,137,248 L828R possibly damaging Het
Mnat1 A G 12: 73,219,090 I253V probably benign Het
Mtfp1 A G 11: 4,093,910 S107P probably damaging Het
Nebl T A 2: 17,379,820 Y65F possibly damaging Het
Nelfb A T 2: 25,205,159 D339E possibly damaging Het
Nlrc3 T A 16: 3,965,631 I20L probably benign Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1487 T A 19: 13,619,745 N151K probably damaging Het
Olfr304 A T 7: 86,385,768 C297* probably null Het
Olfr51 A G 11: 51,007,500 H176R probably damaging Het
Olfr720 A G 14: 14,175,863 I73T probably damaging Het
Olfr725 T C 14: 50,035,151 D84G probably benign Het
Olfr998 T A 2: 85,590,988 Y149* probably null Het
Palm3 A G 8: 84,029,809 E650G probably damaging Het
Prps1l1 C A 12: 34,985,341 L152M probably damaging Het
Rgs7bp C A 13: 105,053,121 V57F probably damaging Het
Scaf8 T A 17: 3,164,183 V171D unknown Het
Sf3a2 T C 10: 80,803,640 Y155H probably damaging Het
Sfrp1 T G 8: 23,411,984 L67R probably damaging Het
Shank2 A T 7: 144,409,875 I407L probably benign Het
Skint6 T C 4: 112,865,675 T902A possibly damaging Het
Skint6 A C 4: 113,156,494 S353R possibly damaging Het
Srrm2 T A 17: 23,808,083 I87N unknown Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svs3b A G 2: 164,256,006 S132P probably damaging Het
Tbc1d17 G T 7: 44,843,002 F412L probably benign Het
Tex29 A T 8: 11,854,263 E116D unknown Het
Tmem204 T C 17: 25,080,338 D69G possibly damaging Het
Ttll10 G A 4: 156,044,762 R308C probably benign Het
Ttn T A 2: 76,747,164 I24462F probably damaging Het
Tubg2 A G 11: 101,161,478 E411G probably damaging Het
Ugt2b38 T C 5: 87,423,771 N134S probably damaging Het
Usp31 T C 7: 121,677,262 T351A probably damaging Het
Usp33 T C 3: 152,360,359 L92S probably damaging Het
Vmn2r20 A T 6: 123,396,470 I471N probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wnk2 A G 13: 49,090,983 V459A probably damaging Het
Other mutations in Adamts1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Adamts1 APN 16 85795573 missense probably benign
IGL01753:Adamts1 APN 16 85802224 missense probably benign 0.00
IGL02238:Adamts1 APN 16 85795825 missense probably benign 0.01
IGL02655:Adamts1 APN 16 85802617 missense probably benign
gambler UTSW 16 85799609 nonsense probably null
sure_thing UTSW 16 85798544 missense probably damaging 1.00
PIT4466001:Adamts1 UTSW 16 85796691 nonsense probably null
R0114:Adamts1 UTSW 16 85799614 missense probably benign 0.10
R0135:Adamts1 UTSW 16 85798703 splice site probably benign
R0179:Adamts1 UTSW 16 85795465 missense probably benign 0.00
R0517:Adamts1 UTSW 16 85800353 missense possibly damaging 0.96
R0526:Adamts1 UTSW 16 85802372 missense probably benign
R0727:Adamts1 UTSW 16 85798648 missense possibly damaging 0.51
R0899:Adamts1 UTSW 16 85798052 nonsense probably null
R1163:Adamts1 UTSW 16 85802637 missense probably benign 0.07
R1555:Adamts1 UTSW 16 85797888 missense probably benign 0.17
R1598:Adamts1 UTSW 16 85798511 nonsense probably null
R1643:Adamts1 UTSW 16 85796817 splice site probably benign
R1847:Adamts1 UTSW 16 85802226 missense possibly damaging 0.89
R2045:Adamts1 UTSW 16 85795976 missense probably damaging 1.00
R2093:Adamts1 UTSW 16 85802445 missense probably benign 0.23
R2966:Adamts1 UTSW 16 85796774 missense possibly damaging 0.94
R3937:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R3938:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R4348:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4350:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4351:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4352:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4470:Adamts1 UTSW 16 85798516 missense possibly damaging 0.88
R4724:Adamts1 UTSW 16 85802505 missense probably benign 0.00
R4775:Adamts1 UTSW 16 85800390 nonsense probably null
R4972:Adamts1 UTSW 16 85795945 missense probably damaging 1.00
R5353:Adamts1 UTSW 16 85802608 missense probably benign 0.00
R5420:Adamts1 UTSW 16 85799609 nonsense probably null
R5551:Adamts1 UTSW 16 85797746 missense probably benign
R5574:Adamts1 UTSW 16 85799642 missense probably damaging 1.00
R5759:Adamts1 UTSW 16 85798048 missense possibly damaging 0.93
R5860:Adamts1 UTSW 16 85798544 missense probably damaging 1.00
R5910:Adamts1 UTSW 16 85802149 missense probably benign 0.00
R6240:Adamts1 UTSW 16 85802157 missense probably benign
R6473:Adamts1 UTSW 16 85799643 missense probably damaging 1.00
R6623:Adamts1 UTSW 16 85795637 missense probably benign 0.20
R6628:Adamts1 UTSW 16 85795825 missense probably benign 0.05
R7034:Adamts1 UTSW 16 85802746 unclassified probably benign
R7174:Adamts1 UTSW 16 85799172 missense probably benign 0.00
R7572:Adamts1 UTSW 16 85797741 missense possibly damaging 0.51
R7759:Adamts1 UTSW 16 85797795 missense probably damaging 1.00
R7808:Adamts1 UTSW 16 85800229 missense probably damaging 0.99
R7880:Adamts1 UTSW 16 85798052 nonsense probably null
R7985:Adamts1 UTSW 16 85798114 missense probably damaging 1.00
R7986:Adamts1 UTSW 16 85799547 missense probably damaging 1.00
R8466:Adamts1 UTSW 16 85802512 missense probably benign 0.42
R8468:Adamts1 UTSW 16 85795556 missense possibly damaging 0.52
R8712:Adamts1 UTSW 16 85798008 missense probably benign 0.28
R8721:Adamts1 UTSW 16 85797887 missense probably damaging 0.96
R8804:Adamts1 UTSW 16 85802412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGAGCCGCATGTCTTG -3'
(R):5'- AGACCTGGGTATCATGACATTG -3'

Sequencing Primer
(F):5'- CGCATGTCTTGGAGCACTC -3'
(R):5'- GACATTGTCACAATTCCTGCTGGAG -3'
Posted On2020-06-30