Incidental Mutation 'R8118:Dsc2'
ID 631372
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 067547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8118 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20165331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.2%
  • 20x: 91.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,592,821 (GRCm39) D792G probably damaging Het
Adcy7 A G 8: 89,042,384 (GRCm39) H417R probably damaging Het
Agr2 A G 12: 36,046,106 (GRCm39) D79G probably benign Het
Ankle1 T C 8: 71,860,279 (GRCm39) S286P probably benign Het
Arhgef11 T C 3: 87,643,164 (GRCm39) S1488P probably damaging Het
Atp6v0a2 T C 5: 124,789,837 (GRCm39) M421T probably damaging Het
Cdk17 C A 10: 93,052,252 (GRCm39) Q111K possibly damaging Het
Cimap2 T A 4: 106,470,595 (GRCm39) R192S possibly damaging Het
Cobl A G 11: 12,204,834 (GRCm39) S623P probably benign Het
Dgka C T 10: 128,558,318 (GRCm39) probably null Het
Dsg2 A G 18: 20,715,858 (GRCm39) I267V probably benign Het
Exoc4 T C 6: 33,948,853 (GRCm39) Y899H probably damaging Het
Fat3 A G 9: 15,871,400 (GRCm39) F3664L probably benign Het
Fbxo47 C T 11: 97,770,341 (GRCm39) C17Y probably benign Het
Gm2888 G T 14: 3,037,628 (GRCm38) V207F probably benign Het
Gpr61 A G 3: 108,057,888 (GRCm39) S258P probably damaging Het
H2-T9 C T 17: 36,438,582 (GRCm39) V270M probably damaging Het
Hectd4 C T 5: 121,424,439 (GRCm39) H700Y probably benign Het
Hs3st2 C T 7: 120,996,651 (GRCm39) T154I probably benign Het
Inf2 A T 12: 112,567,871 (GRCm39) H167L probably damaging Het
Ints3 C T 3: 90,307,606 (GRCm39) probably null Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Itgal C A 7: 126,910,417 (GRCm39) Q509K probably benign Het
Klhl20 A T 1: 160,925,971 (GRCm39) probably null Het
Krtap4-13 C T 11: 99,700,224 (GRCm39) C145Y unknown Het
Large1 A G 8: 73,858,572 (GRCm39) S99P probably benign Het
Lrba A T 3: 86,261,533 (GRCm39) I1496L probably benign Het
Map2 A T 1: 66,464,550 (GRCm39) I1647F probably damaging Het
Map3k10 A G 7: 27,372,842 (GRCm39) V203A possibly damaging Het
Mcmdc2 T A 1: 9,986,599 (GRCm39) N166K possibly damaging Het
Mlxipl T G 5: 135,166,102 (GRCm39) L828R possibly damaging Het
Mnat1 A G 12: 73,265,864 (GRCm39) I253V probably benign Het
Mtfp1 A G 11: 4,043,910 (GRCm39) S107P probably damaging Het
Nebl T A 2: 17,384,631 (GRCm39) Y65F possibly damaging Het
Nelfb A T 2: 25,095,171 (GRCm39) D339E possibly damaging Het
Nlrc3 T A 16: 3,783,495 (GRCm39) I20L probably benign Het
Nup205 T A 6: 35,207,451 (GRCm39) M1501K probably benign Het
Or14a258 A T 7: 86,034,976 (GRCm39) C297* probably null Het
Or1ad8 A G 11: 50,898,327 (GRCm39) H176R probably damaging Het
Or2t6 A G 14: 14,175,863 (GRCm38) I73T probably damaging Het
Or4k15b T C 14: 50,272,608 (GRCm39) D84G probably benign Het
Or5b123 T A 19: 13,597,109 (GRCm39) N151K probably damaging Het
Or5g29 T A 2: 85,421,332 (GRCm39) Y149* probably null Het
Palm3 A G 8: 84,756,438 (GRCm39) E650G probably damaging Het
Prps1l1 C A 12: 35,035,340 (GRCm39) L152M probably damaging Het
Rgs7bp C A 13: 105,189,629 (GRCm39) V57F probably damaging Het
Scaf8 T A 17: 3,214,458 (GRCm39) V171D unknown Het
Sf3a2 T C 10: 80,639,474 (GRCm39) Y155H probably damaging Het
Sfrp1 T G 8: 23,902,000 (GRCm39) L67R probably damaging Het
Shank2 A T 7: 143,963,612 (GRCm39) I407L probably benign Het
Skint6 T C 4: 112,722,872 (GRCm39) T902A possibly damaging Het
Skint6 A C 4: 113,013,691 (GRCm39) S353R possibly damaging Het
Srrm2 T A 17: 24,027,057 (GRCm39) I87N unknown Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svs3b A G 2: 164,097,926 (GRCm39) S132P probably damaging Het
Tbc1d17 G T 7: 44,492,426 (GRCm39) F412L probably benign Het
Tex29 A T 8: 11,904,263 (GRCm39) E116D unknown Het
Tmem204 T C 17: 25,299,312 (GRCm39) D69G possibly damaging Het
Ttll10 G A 4: 156,129,219 (GRCm39) R308C probably benign Het
Ttn T A 2: 76,577,508 (GRCm39) I24462F probably damaging Het
Tubg2 A G 11: 101,052,304 (GRCm39) E411G probably damaging Het
Ugt2b38 T C 5: 87,571,630 (GRCm39) N134S probably damaging Het
Usp31 T C 7: 121,276,485 (GRCm39) T351A probably damaging Het
Usp33 T C 3: 152,065,996 (GRCm39) L92S probably damaging Het
Vmn2r20 A T 6: 123,373,429 (GRCm39) I471N probably damaging Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Wnk2 A G 13: 49,244,459 (GRCm39) V459A probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGCCCCAAATATAACATCTTC -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- GAAGTCGTTCACCTCTTTG -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On 2020-06-30