Mutagenetix > Incidental Mutation

Incidental Mutation 'R8118:Dsg2'

631373

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

MMRRC Submission

067547-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R8118 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20582801 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 267 (I267V)

Ref Sequence

ENSEMBL: ENSMUSP00000057096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]

AlphaFold

O55111

Predicted Effect

probably benign
Transcript: ENSMUST00000059787
AA Change: I267V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: I267V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120102
AA Change: I267V

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: I267V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
Pfam:Cadherin	282	347	6.9e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121837
AA Change: I267V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393
AA Change: I267V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.2%
20x: 91.1%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	T	C	16: 85,795,933	D792G	probably damaging	Het
Adcy7	A	G	8: 88,315,756	H417R	probably damaging	Het
Agr2	A	G	12: 35,996,107	D79G	probably benign	Het
Ankle1	T	C	8: 71,407,635	S286P	probably benign	Het
Arhgef11	T	C	3: 87,735,857	S1488P	probably damaging	Het
Atp6v0a2	T	C	5: 124,712,773	M421T	probably damaging	Het
Cdk17	C	A	10: 93,216,390	Q111K	possibly damaging	Het
Cobl	A	G	11: 12,254,834	S623P	probably benign	Het
Dgka	C	T	10: 128,722,449		probably null	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exoc4	T	C	6: 33,971,918	Y899H	probably damaging	Het
Fat3	A	G	9: 15,960,104	F3664L	probably benign	Het
Fbxo47	C	T	11: 97,879,515	C17Y	probably benign	Het
Gm2888	G	T	14: 3,037,628	V207F	probably benign	Het
Gm7030	C	T	17: 36,127,690	V270M	probably damaging	Het
Gpr61	A	G	3: 108,150,572	S258P	probably damaging	Het
Hectd4	C	T	5: 121,286,376	H700Y	probably benign	Het
Hs3st2	C	T	7: 121,397,428	T154I	probably benign	Het
Inf2	A	T	12: 112,601,437	H167L	probably damaging	Het
Ints3	C	T	3: 90,400,299		probably null	Het
Ippk	C	T	13: 49,446,342	P226S		Het
Itgal	C	A	7: 127,311,245	Q509K	probably benign	Het
Klhl20	A	T	1: 161,098,401		probably null	Het
Krtap4-13	C	T	11: 99,809,398	C145Y	unknown	Het
Large1	A	G	8: 73,131,944	S99P	probably benign	Het
Lexm	T	A	4: 106,613,398	R192S	possibly damaging	Het
Lrba	A	T	3: 86,354,226	I1496L	probably benign	Het
Map2	A	T	1: 66,425,391	I1647F	probably damaging	Het
Map3k10	A	G	7: 27,673,417	V203A	possibly damaging	Het
Mcmdc2	T	A	1: 9,916,374	N166K	possibly damaging	Het
Mlxipl	T	G	5: 135,137,248	L828R	possibly damaging	Het
Mnat1	A	G	12: 73,219,090	I253V	probably benign	Het
Mtfp1	A	G	11: 4,093,910	S107P	probably damaging	Het
Nebl	T	A	2: 17,379,820	Y65F	possibly damaging	Het
Nelfb	A	T	2: 25,205,159	D339E	possibly damaging	Het
Nlrc3	T	A	16: 3,965,631	I20L	probably benign	Het
Nup205	T	A	6: 35,230,516	M1501K	probably benign	Het
Olfr1487	T	A	19: 13,619,745	N151K	probably damaging	Het
Olfr304	A	T	7: 86,385,768	C297*	probably null	Het
Olfr51	A	G	11: 51,007,500	H176R	probably damaging	Het
Olfr720	A	G	14: 14,175,863	I73T	probably damaging	Het
Olfr725	T	C	14: 50,035,151	D84G	probably benign	Het
Olfr998	T	A	2: 85,590,988	Y149*	probably null	Het
Palm3	A	G	8: 84,029,809	E650G	probably damaging	Het
Prps1l1	C	A	12: 34,985,341	L152M	probably damaging	Het
Rgs7bp	C	A	13: 105,053,121	V57F	probably damaging	Het
Scaf8	T	A	17: 3,164,183	V171D	unknown	Het
Sf3a2	T	C	10: 80,803,640	Y155H	probably damaging	Het
Sfrp1	T	G	8: 23,411,984	L67R	probably damaging	Het
Shank2	A	T	7: 144,409,875	I407L	probably benign	Het
Skint6	T	C	4: 112,865,675	T902A	possibly damaging	Het
Skint6	A	C	4: 113,156,494	S353R	possibly damaging	Het
Srrm2	T	A	17: 23,808,083	I87N	unknown	Het
Stard9	G	A	2: 120,704,430	G3723S	probably benign	Het
Svs3b	A	G	2: 164,256,006	S132P	probably damaging	Het
Tbc1d17	G	T	7: 44,843,002	F412L	probably benign	Het
Tex29	A	T	8: 11,854,263	E116D	unknown	Het
Tmem204	T	C	17: 25,080,338	D69G	possibly damaging	Het
Ttll10	G	A	4: 156,044,762	R308C	probably benign	Het
Ttn	T	A	2: 76,747,164	I24462F	probably damaging	Het
Tubg2	A	G	11: 101,161,478	E411G	probably damaging	Het
Ugt2b38	T	C	5: 87,423,771	N134S	probably damaging	Het
Usp31	T	C	7: 121,677,262	T351A	probably damaging	Het
Usp33	T	C	3: 152,360,359	L92S	probably damaging	Het
Vmn2r20	A	T	6: 123,396,470	I471N	probably damaging	Het
Wdfy4	G	A	14: 33,104,115	P1193L		Het
Wnk2	A	G	13: 49,090,983	V459A	probably damaging	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8094:Dsg2	UTSW	18	20583004	unclassified	probably benign
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
R9328:Dsg2	UTSW	18	20582790	missense	possibly damaging	0.81
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACCAGAACAGCATCTTCGGG -3'
(R):5'- TGCTAGCCAGTTATCAGAGCC -3'

Sequencing Primer
(F):5'- CAGCATCTTCGGGAGCTATTAATGTC -3'
(R):5'- GCATGACTTCTACATTGACCTGG -3'

Posted On

2020-06-30