Incidental Mutation 'R8119:Ankar'
ID 631375
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8119 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72647001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1347 (S1347T)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: S1347T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: S1347T

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: S1346T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212573
AA Change: S1129T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik G A 8: 36,498,422 W32* probably null Het
Abca6 T C 11: 110,197,104 I1066V probably benign Het
Abcd2 T C 15: 91,148,994 T740A probably benign Het
Amigo1 T C 3: 108,187,536 L117P probably damaging Het
Apol7e T C 15: 77,717,756 S185P probably damaging Het
Ash1l G A 3: 89,035,427 C2088Y probably damaging Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Caln1 A G 5: 130,822,984 S205G probably damaging Het
Cfap54 T C 10: 92,868,810 I2803V unknown Het
Cfh A C 1: 140,120,015 F477V possibly damaging Het
Cldn23 A G 8: 35,825,902 V144A probably damaging Het
Csmd1 A G 8: 17,027,294 S116P probably damaging Het
Dgkd A T 1: 87,917,967 T299S possibly damaging Het
Fam20b T G 1: 156,690,502 T241P probably damaging Het
Fndc3b A T 3: 27,451,344 M925K probably benign Het
Gm813 C A 16: 58,616,848 M32I probably benign Het
Ints3 C T 3: 90,392,300 R987Q probably damaging Het
Kctd10 A G 5: 114,367,255 V226A probably damaging Het
Lypd2 A G 15: 74,733,032 V38A probably benign Het
Map3k1 T C 13: 111,772,622 R265G possibly damaging Het
Mcc C T 18: 44,468,433 V610M possibly damaging Het
Mocs1 C T 17: 49,449,519 R244C probably damaging Het
Nav2 A G 7: 49,453,484 T677A probably damaging Het
Ngp A G 9: 110,422,353 N150D probably benign Het
Nipbl C T 15: 8,359,212 R308Q probably benign Het
Nsrp1 A G 11: 77,048,351 probably null Het
Olfr1317 T A 2: 112,142,563 I206N probably damaging Het
Olfr1388 A T 11: 49,444,126 I92F probably damaging Het
Olfr659 A T 7: 104,670,854 I51F probably damaging Het
Pbld2 A T 10: 63,053,877 D146V probably benign Het
Prss22 T A 17: 23,994,727 K197* probably null Het
Ptprd G T 4: 76,129,026 S87R probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Slc25a35 T C 11: 68,971,972 L251S probably benign Het
Slx4 A T 16: 3,985,272 L1226* probably null Het
Smarca4 T C 9: 21,647,626 V651A possibly damaging Het
Smarcad1 T C 6: 65,094,319 F583L probably benign Het
Taf2 T C 15: 55,031,130 K932E probably benign Het
Trav8d-1 A T 14: 52,778,968 T104S probably benign Het
Trpm4 A T 7: 45,327,128 V155D probably damaging Het
Ttc6 A T 12: 57,705,643 Y1445F possibly damaging Het
Ttll5 C A 12: 86,020,548 N1270K probably damaging Het
Usp40 G T 1: 87,967,678 probably null Het
Vmn2r74 T C 7: 85,961,482 M1V probably null Het
Wwox T C 8: 114,706,368 V258A probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp770 G A 2: 114,197,027 T187I probably damaging Het
Zranb2 A G 3: 157,536,332 probably null Het
Zscan4-ps3 A G 7: 11,610,340 Q75R probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATGGTGGATCCCTAAAATCTAAG -3'
(R):5'- AGCATGTTCCTGTGCCCTTG -3'

Sequencing Primer
(F):5'- AATGATGTCACTTCTGAAACTTCTC -3'
(R):5'- GGCTACCTCACTTACAATGCACATG -3'
Posted On 2020-06-30